Archive for December, 2020

Landmark 5G Study Highlights Health Threats

https://articles.mercola.com/sites/articles/archive/2020/12/16/landmark-5g-study-highlights-health-threats.

Landmark 5G Study Highlights Health Threats

Analysis by Dr. Joseph MercolaFact Checked

December 16, 2020

5G wireless network
STORY AT-A-GLANCE
  • Newest data from the New Hampshire legislative commission confirms wireless technology produces significant negative effect on humans, animals, insects and plants
  • In the race for hyperfast internet speed and connectivity, experts are making comparisons between the release of 5G and the lies told by the tobacco and oil industries
  • The structure required to support 5G will place cell antenna ports close to your home and workplace, making it nearly impossible to avoid and raising your risk of excessive oxidative stress that may lead to anxiety, depression and Alzheimer’s
  • It is important to get involved in helping to prevent implementation of 5G by contacting your local lawmakers and signing local petitions. Consider taking steps in your home to reduce exposure

Flying under the radar, so to speak, during the media coverage of the COVID-19 pandemic, is the rollout of a hyperfast speed 5G wireless network. As millions of Americans are suddenly working remotely, it has proven to be a powerful opportunity for regulators to move 5G forward. Yet, in the face of expanding wireless connections, a landmark study recommends reducing exposure.

Despite concern by many experts, the implementation is moving forward under the guise of bringing a faster and more efficient internet, at any cost. The term 5G stands for the fifth generation of wireless access, which Jonathon Adelstein, head of the Wireless Infrastructure Association, characterizes as “4G on steroids.”1 The association represents nearly 200 companies in the telecommunications industry.2

However, Adelstein’s characterization of 4G on steroids is not quite accurate. While the 4G network uses under 6 gigahertz (GHz) on the radio frequency spectrum, 5G will occupy from 30 GHz to 300 GHz, which are shorter millimeter wavelengths.3 The health effects of consistent exposure to pulses of these wavelengths have not been thoroughly studied, but the initial evidence shows it is likely dangerous.

If faster speed and reliability are truly the end goals, then fiber optic connections are a far better and safer way forward. It’s not the faster speeds of 5G that are of concern to scientists but, rather, the distribution of wireless data when in most cases it could be routed more easily and less expensively over fiber optic cables.

Newest Data Confirms Past Evidence

Following the passage of New Hampshire House Bill 522, the New Hampshire legislative Commission to Study the Environmental and Health Effects of Evolving 5G Technology was formed.4 The commission was engaged to “study the environmental and health effects of 5G wireless technology in 2019.”5

The commission was made up of 13 members whose education included epidemiology, occupational health, toxicology, physics, engineering electromagnetics and a representative from the wireless industry. As quoted from EMF Safety Network, the commission was asked to answer eight pointed questions, including:6

  • Why thousands of peer-reviewed radiofrequency (RF) studies that show a wide range of health effects, including DNA damage, brain and heart tumors, infertility and many other ailments, have been ignored by the Federal Communication Commission (FCC)
  • Why the FCC guidelines do not account for health effects of wireless technology
  • Why the FCC RF limits are 100 times higher than those in other countries
  • Why the FCC is ignoring the World Health Organization classification of wireless as a possible carcinogen
  • Why, when the world’s leading scientists signed an appeal to protect public health from wireless radiation, nothing has been done

The commission heard from experts and ultimately all except the telecommunication representative acknowledged that RF radiation coming from wireless devices had an effect on humans, animals, insects and plants. The commission wrote:7

“There is mounting evidence that DNA damage can occur from radiation outside of the ionizing part of the spectrum. The Commission heard arguments on both sides of this issue with many now saying there are findings showing biological effects in this range. This argument gets amplified as millimeter waves within the microwave range are beginning to be utilized.”

Their first recommendation was “an independent review of the current RF standards of the electromagnetic radiation in the 300MHz to 300GHz microwave spectrum” to assess the health risks that were linked to cellular communications.8

The remaining recommendations included those that would reduce an individual’s exposure to the 5G network and increase the public’s knowledge and awareness of their exposure.

Included was a shorter minority report written by the business and industry representative and the telecommunications representative, who were not in agreement with the majority of experts. The EMF Safety Network wrote, “This minority report parrots the language of the telecommunications industry and exposes their agenda to ignore science and continue to confuse the public.”9

Safety Is Taking a Backseat to Speed

In much the same way the tobacco industry convinced the public that smoking was not dangerous, so is the telecommunications industry selling the public on speed over safety. In the interview above with Greater Earth Media, IT professional Jon Humphrey made the glaringly obvious comparison between the actions of telecommunication, tobacco and leaded gas industries, saying:10

“So, they know the technology is dangerous and that’s why they’re just trying to get as much of it out there as they can before they’re finally held accountable. Sadly, we’ve seen this all before.

We saw it with big tobacco, we saw it with leaded gas and in every single case the big corporations did what they always do — they lied and then they paid off politicians and they paid scientists and they silenced people and discredited them and sadly they did get away with a lot of it and that’s what we need to make sure doesn’t happen with 5G.”

The promise is that speeds will be from 10 to 100 times faster than 4G running primarily on millimeter-wave (MMW) bandwidth. According to EMF coach and author Lloyd Burrell, the signals will likely be weaker since the wavelengths do not penetrate buildings and tend to be incorporated into rain and plants. To adjust, the 5G network will use:11

“… smaller cell stations (and the technology of beamforming) that’ll scramble/unscramble and redirect packets of data on a no-interference path back to us. This could mean wireless antennas on every lamp post, utility pole, home and business throughout entire neighborhoods, towns and cities.”

This requires a new infrastructure mounting 5G cell stations on existing structures, such as utility poles. During U.S. Senate hearings on the topic, when asked about the safety studies on these small cell stations, representatives from the industry stated they were not aware if any such studies existed.12

This led Sen. Richard Blumenthal, D-Conn., to say, “So there really is no research ongoing. We’re kind of flying blind here.” An article published in Scientific American by Joel M. Moskowitz, Ph.D., director for the Center for Family and Community Health in the School of Public Health at the University of California, Berkeley, identified another challenge:13

“5G will not replace 4G; it will accompany 4G for the near future and possibly over the long term. If there are synergistic effects from simultaneous exposures to multiple types of RFR, our overall risk of harm from RFR may increase substantially. Cancer is not the only risk as there is considerable evidence that RFR causes neurological disorders and reproductive harm, likely due to oxidative stress.”

How Is 5G Different From 4G?

As explained in this video by IEEE Spectrum, part of a large organization devoted to engineering, there are several differences between 4G and 5G technology. Considering there are already many who struggle with electromagnetic hypersensitivity, saturating cities and suburban areas with additional radio frequencies will only add to this once rare affliction.

One of the significant problems with the technology is that it relies primarily on MMW, which is known to penetrate human tissue up to 2 millimeters, where it is absorbed by the surface of the cornea and is conducted by sweat glands within the skin.14 Each of these factors leads to an association with a number of potential health problems.

For example, the U.S. Department of Defense (DOD) is using MMW in crowd control weapons called the Active Denial System because it produces a severe burning sensation. The DOD writes, “The Active Denial System generates a focused and very directional millimeter-wave radio frequency beam.”15

MMW is also known to suppress your immune function16 and increase cellular stress, harmful free radicals, learning deficits17 and, potentially, bacterial antibiotic resistance.18 There is nothing to suggest that 5G will produce less harm than the current technology, and there are thousands of studies demonstrating the harmful effects from that.

Research by Martin Pall, Ph.D., details how excessive oxidative stress triggered by microwave exposure from wireless technology can lead to reproductive harm and neurological disorders, such as anxiety, depression, autism and Alzheimer’s.19

Without the Choice to Opt-Out, What Can You Do?

Once it’s installed in your neighborhood, you won’t have a choice to opt out of 5G exposure. “5G will be virtually everywhere, with the options of being able to simply “get away from it” being very limited as millions of small cell devices are rolled out,” Humphrey says.20

There’s no doubt in my mind that microwave radiation from wireless technologies is a significant health hazard that needs to be addressed if you’re concerned about your health. Unfortunately, the rollout of 5G will make remedial action difficult, which is why we all need to get involved and do what we can to prevent it in the first place, such as contacting your local lawmakers and signing local petitions.

Below are several suggestions to help reduce your exposure and mitigate the damage from wireless technology. In addition, you can download a free chapter from my book, “EMF*D,” that summarizes many of the major recommendations. This is handy to keep on your desktop as a reference as you’re making changes in your home.

Identify major sources of EMF in your home, such as your cellphone, cordless phones, Wi-Fi routers, Bluetooth headsets and other Bluetooth-equipped items, wireless mice, keyboards, smart thermostats, baby monitors, smart meters and the microwave in your kitchen. Ideally, address each source and determine how you can best limit their use.

Barring a life-threatening emergency, children should not use a cellphone or a wireless device of any type. Children are far more vulnerable to cellphone radiation than adults due to having thinner skull bones and developing immune systems and brains.

Research also demonstrates that infants under the age of 1 do not effectively learn language from videos, and do not transfer what they learn from the iPad to the real world, so it’s a mistake to think electronic devices provide valuable educational experiences.21
Connect your desktop computer to the internet via a wired Ethernet connection and be sure to put your desktop in airplane mode. Also avoid wireless keyboards, trackballs, mice, game systems, printers and portable house phones. Opt for the wired versions.
If you must use Wi-Fi, shut it off when not in use, especially at night when you are sleeping. Ideally, work toward hardwiring your house so you can eliminate Wi-Fi altogether. If you have a notebook without any Ethernet ports, a USB Ethernet adapter will allow you to connect to the internet with a wired connection.
Avoid using wireless chargers for your cellphone, as they too will increase EMFs throughout your home. Wireless charging is also far less energy efficient than using a dongle attached to a power plug, as it draws continuous power (and emits EMF) whether you’re using it or not.
Shut off the electricity to your bedroom at night. This typically works to reduce electrical fields from the wires in your wall unless there is an adjoining room next to your bedroom. If that is the case, you will need to use a meter to determine if you also need to turn off power in the adjacent room.
Use a battery-powered alarm clock, ideally one without any light. I use a talking clock for the visually impaired.22
If you still use a microwave oven, consider replacing it with a steam convection oven, which will heat your food as quickly and far more safely.
Avoid using “smart” appliances and thermostats that depend on wireless signaling. This includes all new “smart” TVs as they emit a Wi-Fi signal and, unlike your computer, you cannot shut the Wi-Fi signal off. Consider using a large computer monitor as your TV instead, as they don’t emit Wi-Fi.
Refuse a smart meter on your home as long as you can, or add a shield to an existing smart meter, some of which have been shown to reduce radiation as much as 98%.23
Consider moving your baby’s bed into your room instead of using a wireless baby monitor. Alternatively, use a hard-wired monitor.
Replace CFL bulbs with incandescent bulbs. Ideally remove all fluorescent lights from your house. Not only do they emit unhealthy light, but more importantly, they transfer current to your body just being close to the bulbs.
Avoid carrying your cellphone on your body unless in airplane mode and never sleep with it in your bedroom unless it is in airplane mode. Even in airplane mode it can emit signals, which is why I put my phone in a Faraday bag.24
When using your cellphone, use the speaker phone and hold the phone at least 3 feet away from you. Seek to radically decrease your time on the cellphone. Instead, use VoIP software phones that you can use while connected to the internet via a wired connection.
Avoid using your cellphone and other electronic devices at least an hour (preferably several hours) before bed, as the blue light from the screen and EMFs both inhibit melatonin production.25,26 If you must use your phone make sure you have the blue light filters activated and have it in dark mode.
The effects of EMFs are reduced by calcium-channel blockers, so make sure you’re getting enough magnesium. Most people are deficient in magnesium, which will worsen the impact of EMFs.
Pall has published a paper suggesting that raising your level of Nrf2 may help ameliorate EMF damage.27 One simple way to activate Nrf2 is to consume Nrf2-boosting foods, such as cruciferous vegetables and fermented foods and beverages.28Exercise, calorie restriction (such as intermittent fasting) and activating the nitric oxide signaling pathway (one way of doing that is the Nitric Oxide Dump exercise) will also raise Nrf2.

Category:

Activism

Scam Has Been Confirmed PCR Does Not Detect SARS-CoV-2

**UPDATE May, 2023**

A Portuguese court has ruled that PCR tests are unreliable and that it is unlawful to quarantine people based solely on them.

Citing Jaafar et al. 2020, the court concludes that:

if someone is tested by PCR as positive when a threshold of 35 cycles or higher is used (as is the rule in most laboratories in Europe and the US), the probability that said person is infected is less than 3%, and the probability that said result is a false positive is 97%.

Earlier, the WHO’s testing protocol was even questioned by Finland’s national health authority.

Now we find out that Stanford researchers had a simple test to determine if an asymptomatic person who tested positive for COVID was infectious but CDC and Fauci ignored it.  It was found that the vast majority of asymptomatic individuals who tested positive — 96% — did NOT transmit the virus.  We were even warned by honest virologists about this back in 2020, as well as having the fact play out in reality over and over and over and over again but it was completely ignored by corrupt public health ‘authorities’ because it would have stifled their plan to make the asymptomatic public enemy #2  right after public enemy #1, the unvaccinated, who were blamed for extending the ‘pandemic’ when it’s actually the “vaccinated” that are forcing the virus to mutate.

The CDC particularly pin-pointed the asymptomatic as “silent carriers” to create a boogie-man to be able to continue their fear-mongering, pushing people to test more frequently, and agree to get the completely worthless, experimental, fast-tracked, dangerous COVID gene therapy injections that actually make it more likely to contract COVID, just like the flu vaccine puts you at higher risk for COVID and other respiratory viruses.  They are currently doing it again with asymptomatic bird flu and are prepping a shot for humans “just in case.”

This is their MO.  Learn it well because they do it repeatedly.

Their plan is working beautifully.

The Stanford test would have prevented lockdowns, masks, and the 3 years of tyranny that followed – all of which were fruitless, and in fact made things much worse, which is why they ignored it. It would have put a big ugly dent in their plan.

Faulty testing has also been used against Lyme/MSIDS patients – for over 40 years which continues to this day.  Everyone admits the tests are abominable but nothing is done about it.  

Please keep in mind:
I will say this again for the hard of hearing: never forget these facts, never forgive what was done, and don’t let them get away with it.

https://www.greenmedinfo.com/blog/scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2?

The Scam Has Been Confirmed: PCR Does Not Detect SARS-CoV-2

Posted on:  December 14th 2020 

Posted By:  GMI Reporter

Unofficial English translation of ‘Frauds and falsehoods in the medical field’ originally published on www.dsalud.com

The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed “genome” and even the so-called “target genes” allegedly specific to the “new coronavirus”. The test is worthless and all “positive” results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world’s leading experts on PCR, in fact says that under certain conditions anyone can test positive!

We have been warning you since March: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated for the reasons we explained last month (read the report “Can you prove that there are pathogenic viruses?” on our website –http://www.dsalud.com-). And in the present report we are going to offer new data that show that RT-PCR does not detect the so called SARS-CoV-2 as it is known, but fragments of human RNA and those of numerous microbes.

We have already explained the numerous problems that RT-PCR poses, recognised by organisations or governments such as the WHO or the CDC and by prestigious international experts such as Dr. Stephen Bustin who considers both the arbitrariness of establishing criteria for results and the choice of the number of cycles to be nonsense because they can lead to anyone testing positive.

In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the “human coronaviruses”. And the conclusions are extremely serious: none of the seven “human coronaviruses” have actually beenisolatedand all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea, such as these: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis and a long list of others.

We are going to explain step by step the research that has led us to such an unusual conclusion.

HAVE ANY HUMAN CORONAVIRUSES BEEN ISOLATED?

During the first half of April, when the first research we conducted indicated that SARS-CoV-2 had not been isolated and since those who claimed to have done so were relying on “isolates” of previous “human coronaviruses”, we began to do a thorough review of those claimed isolates. Specifically, we reviewed the alleged isolation work of suspected human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERSCoV (in 2012). And these have been the results:

Coronavirus 229E.

Reference article: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:190-193. January 1, 1966.

Since the authors refer to other articles to explain the method of isolation – which they call Complement Fixation – we consulted a reference article for that method: that of Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):931-938, May 1965. This is a procedure already in disuse that uses the antigen-antibody reaction to detect either one or the other. In the case we are dealing with, the aim was to detect the antigens of the supposed new virus but, as we have already explained, specific antibodies are needed which cannot be obtained the first time a virus is detected.

Coronavirus OC43.

Reference article: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub.

What was considered to be viral RNA was extracted from cultures without any proof that the RNA belongs to a virus.The tool used – a QIAamp kit – removes reagents, inhibitors and contaminants but what it cannot do is determine where the extracted RNA comes from. And there are no controls.It is then amplified by PCR and sequenced assuming (!) that it is genetic information of a virus. Finally, the author speculates about mutations, recombinations, genotypes, molecular evolution, strains and other jargon that conveys the idea -unproven- that a “virus” is being worked with.

SARS-CoV Coronavirus.

Reference article: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

There is no mention of purification in the article. There is not even any mention of filtration or centrifugation. It is only stated that “the viruses were isolated in fetal monkey liver cells from nasopharyngeal aspirates and lung biopsies of two patients”. There are no controls. The only mention is of a “cytopathic effect” that is attributed to a virus and that PCR was done for known viruses and retroviruses without obtaining results. Finally, RT-PCR was done with “random initiators” and a sequence “of unknown origin” is detected to which “a weak homology with thecoronaviridiae family” is found. Then they designed primers for that sequence and when testing 44 samples from SARS patients only 22 were positive.

Coronavirus NL63.

Reference article: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.

The authors state that “the identification of unknown pathogens using molecular biology tools is difficult because the target sequence is not known so that PCR-specific initiators cannot be designed”.

What they used is a tool they developed themselves called VIDISCA which, they claim, does not require prior knowledge of the sequence! Is that possible? Let’s see how it works: first the culture is prepared and it is assumed that a virus is present due to the evidence of “cytopathic effect”. The novelty introduced by this method is that “restriction enzymes” are added, enzymes that cut the nucleic acid molecules at certain locations and always by the same length. In this way, if after the action of these enzymes they observe many fragments of DNA or RNA that are the same or very similar, they deduce that it comes from a virus, since the host genome would present random cuts, while the virus genome presents a large number of copies that are the same due to the replication of the virus. And is such a deduction correct? Of course not! This assumption (which adds to the previous assumption that there is a virus) does not take into account that there are “virus-like particles”, “retrovirus-like particles”, “endogenous retroviruses”, “exosomes”, “extracellular” particles and even mitochondrial DNA. In denial, there are a multitude of particles that possess the same reproductive characteristics in large quantities as “viruses” and therefore can falsify resultsby producing large numbers of identical copies when cut by enzymes as recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that “no redundancy is expected in the VIDISCA insert from the host background nucleic acid except inthe case of ‘virus-like’ characteristics, i.e., high copy numbers as in mitochondrial DNA.

Coronavirus HKU1.

Reference article: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005.

The article, incredibly, begins with these words: “Despite extensive research in patients with respiratory tract infections, no microbiological cause has been identified in a significant proportion of patients. RNA is extracted from non-purified cultures.”And a PCR with coronavirus genes is used. For the sequencing they use two protein databases organised in families, domains and functional sites -PFAM and INterProScan- combined with two computer programs that carry out “predictions” on how nucleotides should be combined. The text adds: “The sequences were manually assembled and edited to produce a final sequence of the viral genome”. And once again there are no controls.

MERS-CoV Coronavirus.

Reference article: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012.

The genetic material is extracted directly from the culture supernatantand sputum sample with a tool called High Puré Viral Nucleic Acid Kit and then tested with different PCRs for various known microorganisms. There is no mention of purification and there are no controls.

In short, what had been done with the first coronaviruses -and with many other supposed viruses– isto cultivate supposedly infected tissues– any “cytopathic effect” was attributed to the presence of a virus only – and then either some proteins are obtained which without anytest are considered “virus antigens” and when these “antigens” are detected in cultures it is interpreted as “isolation”, or fragments of nucleic acids are extracted assuming that they belong to a virus.

We already explained in the article published in the previous issue of the magazine that according to Dr. Stefan Lanka the so-called “cytopathic effect” is actually an effect caused by the conditions of the culture itself. This is recognised for example in the article Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA published on August 15, 2017 on the website of Nature and signed by Andrea Németh and others

(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdfIt explains that certain substances -such as antibiotics- added to in vitro experiments can stress the cell cultures so that they generate new sequences that had not been previously detected. This had already been noticed by none other than Dr. Barbara McClintock in 1983 during her Nobel Prize lecture, as can be seen at https://www.nobelprize.org/uploads/2018/06/mcclintock-lecture.pdf

In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLY BEEN ISOLATED. The only thing that has been different between them are the laboratory procedures and techniques that were becoming progressively more sophisticated which, in this case, has implied not a greater accuracy but a greater capacity for deception and self-deception that has culminated in the virtual manufacture of the SARS-CoV-2.

And the obvious consequence of the lack of evidence of its isolation is that such “coronaviruses” cannot be held responsible for any disease.  Moreover, all tests – of whatever kind – based on the presumed components of these “viruses” (nucleic acids or proteins) are completely disqualified as “infection tests” and even more as “diagnostics” of diseases.

MORE UNANSWERED REQUESTS

In the previous issue we already collected the answers given by the authors of several articles that supposedly described the isolation of SARS-CoV-2 in which they acknowledged that they had not “purified” which implicitly means acknowledging that the virus was not isolated. And now we are going to add one more piece of evidence: the responses given by different authorities – political and health – from various countries about the purification and isolation of SARS-CoV-2.

  • James McCumiskey -author of the book The Latest Conspiracy: The Biomedical Paradigm– tells us that the National Virus Reference Laboratory of Ireland requested information about it from the University of Dublin and the latter responded that“it has no records that could provide ananswer to their request”. The director of legal services of the laboratory insisted on his request to the university and the university responded as follows: “The position of the university is that material of academic debate cannot be subject to the Freedom of Information Act”. It follows from the NVR’s request that they have not cultivated SARS-CoV-2 or purified it. They only acknowledge having “detected SARS-CoV-2 RNA in diagnostic samples.”
  • On June 22, a group of experts sent a consultation in similar terms to British Prime Minister Boris Johnson. The letter was signed by Dr. Kevin Corbett, Piers Corbyn – professor at Imperial College London -, the engineer and independent researcher – who we interviewed in the journal at the time – David Crowe, Dr. Andrew Kaufman, the Edinburgh professor of biology Roger Watson and the biologist and chemist David Rasnick – and to this day they still have not received a reply!
  • Another similar request – in this case to the National Research Council of Canada – received the following response: “We have not been able to carry out a complete search of the NRC’s records so we regret to inform you that no records have been identified that respond to your request.”
  • We will add that two journalists have been sending similar requests – under the Freedom of Information Act – to various institutions in Canada, New Zealand, Australia, Germany, the United Kingdom and the United States, and as of September 5, twelve institutions have responded, all indicating the same thing: that they have no record of work describing the isolation of the virus that is supposed to cause Covid-19. The details and the answers can be seen at:   https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-of-covid-19-virus-isolation/

LOOKING FOR THE ORIGIN OF THE FALSE GENOME

The question we asked ourselves then was: if the sequences that have been published do not belong – as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local Alignment Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results.

First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these:

  • China CDC protocol: uses ORF1ab and N genes as target.
  • Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to be SARS.CoV-2 specific).
  • United States CDC protocol: uses three fragments of the N gene.
  • Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses.
  • Charite Protocol (Germany): uses the E, N and RdRP genes.
  • Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.
  • National Institute of Health Thailand protocol: uses the N gene.

We then introduced the sequence of the primers – the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) – into the BLAST so that it could search for them in two databases: a collection of microbe genomes and the one corresponding to the human genome.

THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES!

Let’s see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)– and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.

We then returned to the home page and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we screen captured again (image 2). And it turns out that the sequence entered coincides with 74 sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%.

And that indicates that the sequence of that initial PCR primer that is supposed to be specific to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well!

We then decided to repeat the operation but with the final or reverse primer – which is CTCCCTTTGTGTGTGT – and the results were similar.

Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the “SARS-CoV-2 genome” and although thousands of laboratories claim to have isolated and sequenced it – a false claim as we have explained in previous reports- we decided to go to the National Centre for BiotechnologyInformation website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903. Once there, we located the “target sequence”, a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the “genome”, which is this one:

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.

With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100% and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed “target sequence” of SARS-CoV-2 both in microbes and in our own genome.

Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472:

ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCGATTCTGGTCTAA.

We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage of identity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen atrandom and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid.

We finally decided to test with the S gene which is said to generate the structural “spike” proteins that are key to entry into the cell and was subsequently considered to be the most specific SARS-CoV-2 gene. Since it is a gene whose sequence is much longer – 3821 nucleotides between positions 21,563 and 25,384 – we tested with two fragments chosen at random within that gene and the first – TTGGCAAAATTCAAGACTCACTTTC – resulted in another hundred microbe sequences and 93 sequences of the human genome and the second – CTTGCTGCTACTAAATGCAGAGTGT – a hundred microbial sequences and 90 of the human genome.

Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were once again similar: a hundred microbe sequences and 93 sequences of the human genome with an identity percentage between 94.12% and 100%!

CONCLUSIONS

The consequence of all that we have just explained is clear and immediate: THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that

ALL THE NUMBERS OF “CASES”, “INFECTED”, “SICK”, “Asymptomatic” OR “DEAD DUE TO COVID-19” LACK A SCIENTIFIC BASE AND ALL “POSITIVES” ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable.

We end by adding that even the WHO itself does not really believe in these tests. Just read the document published last September 11 as a laboratory guide for SARS-CoV-2 entitled Diagnostic tests for SARS-CoV-2 – it is available at https://apps.who.int/iris/rest/bitstreams/1302661/retrieve– and it literally says on page 5: “Whenever possible, suspected active infection should be tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target”. That is, WHO agrees to use non-specific sequences to detect SARS-CoV-2.

That is not all because the manual later states, “An optimal diagnosis consists of a NAAT test with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used.”

The WHO manual states, “One or more negative results do not necessarily rule out SARS-CoV-2 infection.There are a number of factors that can produce a negative result in an infected individual including poor quality of the sample, late collection of the sample, inadequate handling, or technical reasons inherent in the test, such as mutation of the virus or inhibition of PCR.”

What are the judges waiting for to act on their own initiative?

Jesus Garcia Blanca

Note: the author publicly thanks Juan Pedro Aparicio Alcaraz for his patient and meticulous collaborative work in the search for scientific articles and for his tedious work with the BLAST.

THIS REPORT APPEARS IN (https://www.dsalud.com/revistas/numero-242-noviembre-2020/)

Disclaimer: This article is not intended to provide medical advice, diagnosis or treatment. Views expressed here do not necessarily reflect those of GreenMedInfo or its staff.
__________________________
**Comment**
I’ve been posting on this since March.  This lack of viral purification is foundational. Without it no test or vaccine will be effective, yet everything stems from it.  Again, I can not recommend the book, “Virus Mania” more highly to understand this critical issue that unless dealt with, will continue on unabated with future supposed viral ‘pandemics’ that aren’t.  https://www.torstenengelbrecht.com/en/virus-mania/
For more:  
Lastly, for your dose of daily humor, an Austrian lawmaker tests cola for COVID-19 and it’s predictably positive:  https://www.rt.com/news/509377-austria-mp-test-cola-covid-positive/
IMG-20210506-WA0003

Category:

Activism, research, Testing, Viruses

Ozone for Newbies Webinar Tonight

Webinar: Ozone for Newbies

Click below to sign up for a free webinar on Thursday (12/18) 
at 8PM Central Time. 

What is something you have always wanted to know about ozone?

My goal for this webinar is to give you a place for asking any ozone therapy question you have and to teach you the basics of ozone therapy.

You will be able to interact and ask questions during this live webinar!

The webinar starts this Thursday (12/18) at 8PM Central.

Click the link to sign up and get reminders as it gets close.

Click here to register 
https://event.webinarjam.com/register/21/k3851al

Looking forward to learning with you, 

Jason DeLeon – Professional Ozonaut
P.S.  If you can’t make it, you can still sign up and get the video afterward!  Click here to register

Category:

Activism, Treatment

What Makes Ticks Tick: Researcher Studies Their Every Move

https://www.lymedisease.org/what-makes-ticks-tick/

What makes ticks tick: researcher studies their every move

ticks Illinois state

By Kate Arthur, Illinois State University

Few researchers have studied how a tick’s brain works, but that’s what caught the attention of Dr. Carola Städele.

As a post-doctoral researcher in the School of Biological Sciences, she studies a tick’s every move by recording them as they crawl around their Plexiglass home.

“A lot of people think ticks just climb up on grass and wait until something passes by to cling on,” she said. “If it’s a good host, they will bite, and if not, they’ll fall off and start over. This is not how I think ticks are. They are way too successful to just be opportunistic.”

Because ticks transmit a host of diseases, most researchers are interested in the saliva that causes diseases like Rocky Mountain spotted fever and Lyme disease. But tick sensory physiology has been largely ignored, she said.

What attracts ticks?

“I’m trying to understand what ticks find attractive, and how their brains determine attractiveness. Most tick research focuses on tick pathology and ecology, understanding how they perceive the world.”

Ticks may find their hosts by detecting the carbon dioxide animals give off as they breathe, she said. In her lab, she records how ticks respond to changes in carbon dioxide levels, analyzing changes in walking speed and direction.

“If my hypothesis is true, the next question is, how do they sense that CO2—what are the organs that allow them to detect it and how do these organs work?”

Learning how ticks detect potential hosts can allow you to interrupt that behavior, she said.

“You can find substances that don’t allow the ticks to detect carbon dioxide anymore, meaning if the ticks use that to find hosts, it makes it more difficult to find them.”

“It’s very fair to say there are opinions about ticks, people who think ticks are just tiny blood-sucking machines, and people who are convinced ticks show very complex behaviors and are very selective; we just don’t understand it yet.”

She seeks to understand ticks, not eradicate them

Tick populations are on the rise. But she wanted to be clear that she is not trying to eradicate ticks. She only wants to understand them.

“I’m a biologist and I don’t see myself as an eradicator of species. I don’t know if there’s a positive effect in the environment if there are ticks present. There are definitely negative effects, and my research may help to control some of them. Ultimately, no biological study can easily undo the disruption of natural habitats, loss of important tick predators, and increase in tick numbers due to climate change.”

Ticks carry pathogens that cause human diseases, and one way to interfere with transmission is to understand what makes ticks tick.

“It’s very fair to say there are opinions about ticks, people who think ticks are just tiny blood-sucking machines, and people who are convinced ticks show very complex behaviors and are very selective; we just don’t understand it yet,” she said.

“If you want to understand behavior, neuroscience is necessary. What triggers behavior is our nervous system and if you don’t understand the nervous system, you will never fully understand behavior.”

Dr.-Carola-Staedele, ticks

Dr. Carola Städele studies how the presence of carbon dioxide affects a tick’s movement. It may explain how they find their hosts.

Städele was a visiting researcher at Illinois State from 2012 to 2015, where she performed the experimental part of her doctoral degree, leaving to pursue a postdoctoral position at the University of California, Los Angeles.

Interrupted by pandemic

She returned to ISU in March, as the pandemic hit. Under Illinois’ stay-at-home order, she couldn’t work in her lab, and didn’t have any data to analyze. She used that time to connect with researchers all over the world as universities made their seminars available online.

Chosen for a prestigious fellowship with the Marine Biological Laboratory in Wood Hole, Massachussets, she was supposed to spend her summer there, with nine other Grass Foundation fellows. Instead, they met over Zoom, and their fellowship was extended so they can do their independent research there next year.

This semester, Städele is working with a young researcher, senior Sabrina Sedekum. It’s the first research experience for the zoology major, who is analyzing leg movement through the “tick on the stick” approach. A pin is glued to the tick’s back, holding the tick steady while it walks on a hard plastic ball that allows tracking of its movements. She reviews the video, analyzing the movements of each of its eight legs.

Patterned behavior

“It’s pretty cool,” Sedekum said. “They either started moving or stopped moving when they detected carbon dioxide. Seeing even tiny creatures exhibiting patterned behavior is fascinating to me. I thought I hated bugs but seeing these little guys move around is really interesting.

Städele, who describes herself as a “vivid outdoor person” is no stranger to ticks.

“I see ticks everywhere,” she said. “I am literally a tick magnet.”

She has some advice for hikers. Wear light-colored clothing to make them easier to spot and take a shower when you get home. Ticks can crawl on your body several hours before they find a suitable spot. If one has dug in, don’t panic. She has a solution, but it’s not for the squeamish.

Take a needle and try to remove the head without breaking or squeezing it. Otherwise, the head will be stuck in your skin and can cause infection. If it’s attached to your scalp or you see an infection at the biting site, see a doctor.

PRESS RELEASE SOURCE: Illinois State University

Related Posts:

  1. A closeup look at how ticks use smell to find future hosts
  2. TOUCHED BY LYME: Unfortunate news for young MA tick researcher
  3. What makes Australians sick after a tick bite?
  4. NEWS: To Fight Tick-Borne Disease, Someone Has To Catch Ticks

Category:

research, Ticks

Weaponized Ticks/Human Experiments/The Lyme Disease Truth With Kris Newby

http://  Approx. 55 Min

Dec. 14, 2020

Weaponized Ticks/Human Experiments/The Lyme Disease Truth with Kris Newby

With Chris Mathieu

Forbidden Knowledge News

The censorship mentioned is very real.  I was just kicked off LinkedIn.  It’s going to be harder to find information that does not follow the accepted narrative spun out by our public ‘authorities’ and main stream media whom have severe conflicts of interest.

We are indebted to all of Newby’s work.  She is behind the documentaries “Under Our Skin”and “Emergence” which accurately portray what Lyme/MSIDS patients experience.  I diagnosed myself and my husband by watching these.  

We are still waiting to hear the results of an investigation into all of this (don’t hold your breath – you will pass out first):  https://madisonarealymesupportgroup.com/2020/07/22/house-passes-chris-smith-measure-to-probe-if-government-turned-ticks-into-bioweapons/

For more:  

Lastly, here’s a short piece of Willy Burgdorfer shortly before he died where he candidly explains Lyme/MSIDS is far from a simple illness and is nearly impossible to find.

http://

Dec. 1914

There’s many similarities between how Lyme/MSIDS AND COVID-19 have been mishandled.

For more:  

Help keep FKN alive with a Donation https://www.paypal.me/forbiddenknowle…

Our website https://forbiddenknowledge.news/

Watch live on Dlive: FKNlive https://dlive.tv/FKNlive

Forbidden Knowledge News on LBRY.com https://open.lbry.com/@forbiddenknowl…

Category:

Activism, Lyme, Ticks