The FDA has failed to warn of the potential for this reaction in its “fact sheet’ for the Pfizer vaccine.
Bell’s palsy and transverse myelitis ARE on the package insert for the anthrax vaccine right here.
The label was reproduced in the National Academy of Sciences’ report on anthrax vaccine, but it is hard to find online… since FDA removed the warnings from a later version of the label.
Rational Ground, a “clearinghouse of COVID-19 data trends run by a grassroots group of data analysts, computer scientists, and actuaries,” conducted an analysis on all 50 states, dividing them between those with mask mandates and those without.
States with mask mandates have a greater COVID spread.
States with mask mandates had an average of 27 cases per day (per 100,000 people), whereas states without mask mandates had an average of 17 cases per day (per 100,000 people).
No matter how much you want to believe masks work, the data continues to show they do not help prevent COVID, and they often cause adverse health issues of their own.
This article gets longer by the day due to new information coming to light. I encourage you to also scroll down to the updated VAERS reports as well as a long list of adverse reactions and death at the end. It is quite illuminating.
Now, a twice-censored paper has shown that 74% of deaths were independently adjudicated as directly due to or significantly contributed to by COVID-19 vaccination. Another paper has shown the gene therapy injections caused nursing home deaths to soar.
And, a Senate report has exposed how federal health officials ‘downplayed’ injection risks and failed to warn the public.
Doctors receive extremely limited training in “vaccine” science, and according to viral immunologist and vaccinologist Dr. Byram Bridle, doctors in Canada only receive approximately 5-12 (50 minute) lectures in the first year of their program which yields a total of about 15 minutes of information about vaccines, which means the average physician has only the most superficial understanding which gives them the ability to read the package inserts!
Bridle is the one who broke the news that the spike protein in the COVID shots is a dangerous toxin. He has been certified as an expert witness for scientific matters related to COVID in Canada and has also provided evidence that most people have already acquired robust immunity to the virus without “vaccination,” and that there is no scientific basis justifying the use of “vaccine” mandates to reduce the transmission of COVID. He states that the injection causes significant side-effects, which for many will be worse than the infection itself. Please see his affidavit which explains much more. Now, Japanese researchers have shown the spike protein continues to damage blood vessels for up to 17 months.
A CA nurse states a CA hospital “deliberately and selectively” concealed from staff, patients and regulators a spike in unborn baby deaths that began in spring 2021, and retaliated against her when she publicized the information.
A whistleblower revealed hospitals are covering up fetal deaths by quickly cremating the babies.
Here, we listen to Dr. James Thorp, an OB-GYN, explain the Shimabukuro study in which 21 authors reported in 2021 that the miscarriage rate of ‘vaccinated’ mothers was 12.6% but the raw data revealed an 82% miscarriage rate in women ‘vaccinated’ in the first trimester, which mirrors the effects of chemical abortion drugs such as RU486.
Thorpe was one of the persecuted after finding 37 adverse pregnancy outcomes significantly associated with the COVID shot.
Dr. Thorp is also seeing an increase in fetal malformation, cardiac arrest, placental thrombosis, and VAIDS (vaccine induced acquired immune deficiency).
A rat study showed the shot destroyed 60% of ovarian reserve.
A study published in “Andrology” found “a selective temporary decline of sperm concentration and total motile count 3 months” after men were given the COVID-19 mRNA vaccine. Please watch this important 2 Min. video of highly experienced German pathologist Dr. Arne Burkhardt who shows that sperm is almost completely replaced by Spike Protein in the “vaccinated.”
More than 30,000 reports of menstrual irregularities and vaginal bleeding have been made to the UK system for collecting and monitoring adverse reactions.
A new study claims that COVID-19 “vaccines” can pass mRNA through breastmilk.
Numerous reports of reduced milk flow, green milk, mastitis, and thrombophlebitis in the breast in breast-feeding mothers. Nursing babies also suffering from blood clots, severely inflamed arteries, rashes, vomiting, and even death after mothers got the COVID shots.
Pathologist Dr. Ernie Burkhardt died a mysterious death after an EU presentation where he found that in 77% of autopsies, the ‘vaccine’ had an important impact on the death process, and that the endothelium was ripped to shreds.
He also gave the following advice:
“If I were a woman of fertile age, I would not plan a motherhood with a man that has been vaccinated.” ~ Dr. Burkhardt
But, everyone continues to ignore the very real elephant in the room…..the mRNA gene therapy shots, purposely designed for depopulation. Vaccines have long been used for class and race profiling.
CDC and FDA officials opted not to update the V-safe program to include cardiac-related symptoms, the report said.
Unfazed, FDA advisers vote on yet a new COVID ‘vaccine’ formula amid calls to pull the shots off the market
The Senate report makes public the CDC’s 148-page report on myocarditis after the COVID-19 injection in which initiallyevery single word is redacted. The redactions include Biden White House talking points emailed to Walensky, Fauci, and Collins which made misleading claims about the efficacy of the COVID shots and downplayed myocarditis risk.
Speaking of efficacy: a researcher recently revealed how they were able to fraudulently make an ineffective injection close to perfect: a testing policy that made it mandatory to test the unvaccinated 2X/week, but the unvaccinated aren’t tested at all. This massively skews all studies based on this data. Then to cinch the deal, they didn’t compare the whole period all-cause mortality between those who got the shots and those who did not.
If you can’t get COVID, you can’t die from COVID!
What a perfectly diabolical plan.
BAM! The magic trick has been revealed. The next time you want to make a ‘vaccine’ super effective, there is nothing like deploying a differential testing policy like this.
We’re witnessing an “active cover-up” of a “colossal consumer product safety debacle that has basically affected the entire world.” ~ Dr. Peter McCullough
FOIA requests have proven that Pfizerand the CDC withheld evidence that those who receive the COVID shot are at an increased risk of myocarditis.The FDA is on on the coverup as well as it asked for 50 years to release this damning data it used to license the shots. Thankfully, a court ordered the release 55,000 pages a month; however, the FDA will redact informationit decides is not for public consumption and it conveniently has labeled a large number of serious adverse events, often requiring hospitalization as “unrelated” to the shot. The cover-up continues.
But, studies and reality continue to show the truth:
spike protein in heart cells within 48 hours of injection
1 in 35 had “vaccine” associated myocardial injury
Israeli study shows Pfizer shot increases myocarditis threefold
teens injected with Pfizer or Moderna shot at higher risk of heart inflammation
study shows a 9-fold increase of myocarditis in males after the booster
AHA study links shots with increased heart attacks
Since 2021 doctors have been deeply concerned about the possibility that mRNA COVID shots impair the immune system’s ability to suppress the growth of cancer cells.Predictably, this important information is simply retracted by ‘the powers that be’. The Moderna patent actually admits that contaminants (DNA) in the shot cause cancer, birth defects, as well as anything associated with DNA damage, but the FDA ignored the admission when approving the shots.
A pathologist has reported on the cancers she is finding in the “vaccinated.”
A published report concluded that mRNA shot caused a case of fatal cancer.
An epidemiologist states that cancers are occurring in excess in the “vaxxed.”
A toxicologist recently stated that clinical trial participants received a “clean shot,” but the public got plasmid contaminated shots, and that gene therapy was never brought to market in 40 years – until now because in the past it caused latent cancers that developed 2-4 years after it was given because it caused lethal autoimmune reactions. The COVID shots are infinitely worse because they send an unneeded sequence forcing the body to make a piece of viral protein which displays on cells, causing the body to attack and kill those cells.
On top of this, the shots contain SV40 sequences (contaminants found in Polio vaccines) within the plasmids that were not disclosed to the regulators. This sequence which is thought to have caused cancers for decades, takes the DNA into the nucleus of human cells where it can be integrated.
There’s also the connection between 5G, DNA damage, COVID and cancer.
Leading scientists have been warning for some time that surges in deadly cancers among the Covid-vaxxed were caused by DNA fragments in the mRNA injections.
A major investigation by German researchers confirmed that DNA contamination exceeded safe levels by 300-500 times.
A genomics scientist with 25 years of experience gene-sequenced a cancerous tumor, matching the genetic sequence to Pfizer’s shot.
New, aggressive ‘turbo’ cancers are being seen by doctors, including pro-vax Deion Sanders, who due to blood clots had toe amputations and multiple surgeries.
Official government data shows a spike in turbo cancer deaths in young people aged 15-44 since 2021. Data expert Ed Down found the following in the U.K. :
A 28% rise in fatal breast cancer rates in women.
An 80% increase in pancreatic cancer deaths among women and a 60% increase among men.
A 55% increase among men in colon cancer deaths and a 41% increase in women.
A 120% increase in fatal melanomas among men and a 35% increase in women.
A 35% increase in brain cancer deaths among men and a 12% rise in women.
A 60% increase in cancer death rates among men in cancers “without site specification” and a 55% increase among women.
Nurse Manager Tiffany Dover from CHI Memorial Hospital in Chattanooga, TN Story and video.
by Brian Shilhavy Editor, Health Impact News
Article Excerpts:
The first week of injecting American healthcare workers with the experimental illegal Pfizer mRNA vaccine has resulted in over 3000 of these healthcare workers reporting that they were injured to the extent that they could not continue on their jobs and perform normal activities, requiring care from a doctor or healthcare worker.
This report is directly from the CDC and was published yesterday, December 19, 2020.
For example, we published the video of the press conference in Chattanooga, Tennessee earlier this week where Nurse Manager Tiffany Dover passed out live on camera just after she was vaccinated with the Pfizer COVID experimental vaccine.
The doctors at CHI Memorial Hospital, and the nurse herself, tried to reassure the public that her passing out had nothing at all to do with the vaccine she had just received.
(See link for article)
________________
According to this 2020 video and article, Dover, who promptly passed out after the shot, explains she suffers from an overactive vagal response to minor pain which can cause fainting. Many believe this is damage control since a nurse passing out 6 times in 6 weeks and stating “even a hangnail” can do it, has no business working with critically ill patients and would be the last person on earth to demonstrate a new COVID injection.
While the hospital where she works insists she is still alive and employed there, this article details how NBC reporter Brandy Zadrozny did a multiple part podcast on Tiffany Dover, claiming to be tired of all the “conspiracy theorists” and the where-abouts of Dover. While she stalked Dover’s family, co-workers, and kids for weeks, no new or useful information was presented. She ends up putting someone’s voice on the podcast and states it’s Tiffany Dover and to just trust her.
Never once did she get Dover on camera.
Despite the attempts of many “fact-checkers, this article explainsDover appeared for the last time publicly in a video four days after the shot on Dec. 21, 2020and she did not look well. “Fact-checkers” have only relied upon statements from Dover’s employer and family despite the fact Dover’s family allude to a nondisclosure agreement and a “major scandal” but nobody followed up on these details. It is highly likely Dover is being pushed into silence by powerful forces, if she’s alive at all.
The only update to Tiffany Dover’s social media accounts was a single Instagram post on 26 Feb 2021 where ‘she’ wrote cryptically: ‘Meet me on the other side of paradise’.
Whatever the truth is, we will probably never know it and something definitely smells rotten in Denmark.
The Buffalo Bills player collapsed on a live televised game. He then spent several days in the ICU, three of which were on a ventilator.
Commentator Toby Rogers, Ph.D., M.P.P, states Big Pharma took to #MedTwitter within minutes of the collapse to “flood the zone with a lie — that the heart attack was definitely the result of ‘Commotio Cordis,’” to set a narrative that would become unbreakable.
Many cardiologists question the narrative and after scouring the literature are unable to find any documented cases in the 103 years of NFL history.
“Vaccination” is highly likely the cause.ABC News reported in October that the NBA, NFL, and MLS have “vaccination” rates greater than 90% with the NHL and WNBA at over 99%.
Then there’s the extremely uncomfortable interview where he refuses to answer how doctors describe what happened to him.
Others used as “vaccine”poster boys have sadly died after the COVID shots.
Hank Aaron – also used as a poster-boy died after the shot, which predictably is being blamed on #ABV. The deaths continue to mount, but it’s always #ABV.
Please also see this article that shows details, as well as this video exposing many more are passing out and even dying after these injections. Interspersed throughout the video are experts. One states:
“They coded the deaths. They said, “Did the vaccine cause [death] or was there some other cause? 86% of the time, there’s no other cause. 50% of the deaths occur within two days of taking the shot; 80% occur within a week.” ~ Dr McCullough
In March, 2022 a CDC peer-reviewed study shows that COVID injection DEATHS represent 1.3% of reported side-effects and 6.6% were serious. This of course led the CDC to quietly adjust their metrics for measuring COVID risk, purposely using manipulation to make it appear the pandemic was easing up. We went from 90% of the country in high-risk red zones to overnight, having less than 30% of the country in high-risk orange zones. The CDC constantlymanipulates and withholds data.
These number show that more adverse reactions and death have occurred since the rollout of the COVID gene therapy injections than any other vaccine in the history of VAERS. In the UK, these injections have caused more adverse reactions than ALL other vaccines in the last 40 years.
It was the summer of “Died Suddenly” with 88 deaths (and counting) of athletes and former athletes who were in prime condition.
**Moderna received 300,000 reports of side-effects after a 3-month period following the launch of its shot according to an internal report from a company that helps manage its reports. This is much higher than what the company has made public**
By comparison, during the same time period VAERS received reports of 83 deaths following flu vaccines.
And for a further perspective on the magnitude of deaths, the current death count exceeds the total number of deaths reported to VAERS for the past 30 years.
The Cutter Polio Vaccine was pulled in 1955 after 10 deaths.
The Swine Flu Vaccine was pulled in 1976 after 20-50 deaths.
The RotaShield Vaccine was pulled in 1999 after 10-15 cases of bowel obstruction.
The Chikungunya Vaccine was pulled in 2025 after 3 deaths. Source
The reason the earliest two were shut down is simple: it happened before vaccine manufacturers got a free pass.
According to 42 U.S. Code § 300aa–22, “No vaccine manufacturer shall be liable in a civil action for damages arising from a vaccine-related injury or death associated with the administration of a vaccineafter October 1, 1988, if the injury or death resulted from side effects that were unavoidable even though the vaccine was properly prepared and was accompanied by proper directions and warnings.” Source
In other words, vaccine manufacturers are not liable if someone has an allergic reaction, injury, or dies after being “vaccinated.”
Reports to VAERS are voluntary. Historically only 1% of vaccine injuries & deaths are reported. The system has been backlogged by months possibly indicating there are so many reports coming in that that the CDC can’t handle them and that the true numbers of adverse reactions are not reflecting reality.
The European Union database now shows nearly over 50,000 deaths and nearly 5,350,000 injuries following the injections
A Health Impact News subscriber in Europe ran the reports for each of the four COVID-19 shots we are including here. It is a lot of work to tabulate each reaction with injuries and fatalities, since there is no place on the EudraVigilance system that tabulates all the results. Others from Europe have also calculated the numbers and confirmed the totals.*
Go here to listen to a member of the European Parliament speak out against these experimental injections. Each of the members gave powerful testimony for medical freedom.
“I will not be reduced to a mere guinea pig by getting vaccinated with an experimental drug, and I will most assuredly not get vaccinated because my government tells me to and promises, in return, I will be granted freedom.
Let’s be clear about one thing: No one grants me freedom for I am a free person.” ~ Christine Anderson, German member of the European Parliament
Besides getting a free-pass for any injuries caused by the jab, a leaked Zoom call reveals a Pfizer scientist admitting that Israel is a laboratoryfor the Pfizer shot. Israel has an exclusive agreement to use only Pfizer injections – and by looking at the Israeli population, they can predict what will happen in the U.S. a couple of months later. An Israeli doctor states the “vaccine” is not working as 90% of hospitalizations are among the fully “vaxxed,” with many seriously injured.
But it’s all good for Pfizer as a leaked document reveals that Pfizer is demanding countries put up sovereign assets, bank reserves, military bases, and embassy buildings as collateral for expected lawsuits. They also admit in black and white that safety and efficacy is UNKNOWN.
COVID Injections Produce ‘Toxic’ Effects, British Researchers Call On Governments To ‘Halt Use Immediately’.
130 UK medical professionals accuse UK minister and government officials of causing “massive, permanent and unnecessary harm” to the country.
CVS Pharmacist Whistleblower Quits Over Refusal to give COVID-19 Shots (Video)
The pharmacist states:
CVS was advertising for the longest time for PRN casual pharmacists. They were advertising paying $6500 a week to pharmacists who would go to nursing homes to give COVID shots.
That’s $6500.00 a week, per pharmacist per neighborhood area, per community, per city, per region, per county, per state, for the whole United States. This is mainly a result of Operation Warp Speed from last year, that gave a blank check to Big Pharma to distribute these injections that many doctors and scientists are now calling “bioweapons.”
This is where states are getting their millions of dollars to entice people to get the shots with lotteries, free beer, free marijuana, and many other incentives, along with a $BILLION dollar advertising campaign designed to use propaganda to fool the public into believing that these shots are safe and necessary to “return to normal.” Source
The CDC and FDA met in June and finally admitted that there were hundreds of reported cases of Myocarditis and pericarditis (inflammation of the heart) following mRNA shots. Prior to this meeting, the only thing they were willing to admit was that there were “rare” cases of blood clots in the brain, while choosing to ignore a myriad of other reported conditions, including many other types of blood clots.
Regarding Children
According to a FOIA request, the CDC can not provide a single confirmed COVID death in a child younger than 12 or in a child 12-15. Newly released data show thatnot a single healthy young person under the age of 50 has died from COVID-19 in Israel, ever.
But deaths among European children aged 1-14 have increased by 552% since the EMA approved the COVID shot for kids, and while researchers found the mortality rate for minors aged 1 through 19 soared by almost 20% between 2020 and 2022, the alarming spike cannot be ascribed to the COVID-19 virus.
Injecting children with an experimental gene therapy, who rarelyget COVIDor transmit it, and have more than a 99.9% chance of surviving is the height of insanity. A team of Johns Hopkins researchers recently reported that when studying a group of about 48,000 children, they found zero COVID deaths among healthy kids, and a new study from Germany shows extremely few deaths among healthy children overall and ZERO deaths in 5-11 year olds, suggesting most studies are designed to distort the risk to kids. Go here to read and listen to Dr. Prasad on how many are citing research that is flawed.
Research from Seattle Children’s Hospital found two key markers of heart inflammation within a week of getting a second dose of Pfizer’s shot were elevated
Cardiac imaging 3-8 months after they were first examined showed persistent gadolinium enhancement (a heart abnormality).
Follow up imaging revealed abnormal global longitudinal strain (a measure of heart function) in 3/4 of patients.
A cardiologist not involved with the study states that 60-70% of teenswho get myocarditis from the COVID shots may be left with a scar in their heart.
A survey among youth whose conditions were reported to the CDC at least 90 days after they first experienced symptoms found that about half were still suffering from at least one symptom, such as chest pain, and 4 in 10 were still on exercise restrictions months after experiencing the inflammation, a parallel survey with the patients’ health care providers found.
Providers disclosed that cardiac imaging done months after symptoms appeared still showed abnormalities for some patients, with late gadolinium enhancement being the most frequent.
A recent report by Public Health Ontario showed heart inflammation following these shots is significantly more prevalent in young people, with over 100 needing hospitalization for “vaccine”-related heart problems.
A preprint study, showed healthy boys between ages 12-15 were 4-6 times more likely to be diagnosed with myocarditis from the COVID injections than they were to be hospitalized with COVID. As of Nov. 24, 2021, VAERS has received 1,949 reports of myocarditis or pericarditis among people ages 30 and younger who got the jab. There are currently 666 cases of carditis after the shots in the 12-17 age range. To date there have only been 630 deaths in 17 year olds and under who tested positive for COVID, which again, may or may not be the only cause of death. We can truthfully say that more children have died from the injections than the disease itself, and those numbers are only going to increase.
A respected geneticist has issued a warning for young people stating,
“the risk is higher to be vaccinated by Astra-Zeneca than not to be vaccinated. That’s it. It’s as clear as that.”
Large U.K. study, the most comprehensive on the topic to date, backs up clinical reports that show children and teens are less likely to be hospitalized or face severe effects from the virus. The UK advisory panel does not recommend COVID injections to healthy 12-15 year olds due to the potential of heart inflammation. They also state children are at such a low risk from COVID that the jabs offer only a marginal benefit.
Finally, the WHO has seen the light and now states, “Children should not be vaccinated for the moment.” The WHO truly meant “for the moment” because 48 hours later it did an about face. Seems our public health authorities flip flop more than a waffle maker.
“Breakthrough” Cases
In April 2023, a peer-reviewed study by the Cleveland Clinic shows that the more doses of COVID shots a person receives, the higher the risk of getting the virus. Thismeans the “vaccinated” are now a risk to the unvaccinated and the elderly, but will anyone state this? Nope. Will the “vaccinated” lose their jobs and be bullied like the unvaccinated have been? Nope.
On March 29, 2022 – a 100% “vaccinated” cruise ship (Ruby Princess) was hit with a COVID outbreak. Everyone was tested and had to show proof of “vaccination” before boarding. Those testing positive who were asymptomatic or mildly symptomatic were quarantined and monitored.
While the CDC admits “vaccine” “breakthrough” cases are fully expected & that no “vaccine” is 100% effective, Bloomberg data from 35 states shows 111,748 breakthrough cases in the U.S. through the end of July.
This is 10 TIMES the CDC’s count when they stopped tracking breakthrough cases(except for hospitalizations and deaths) in May when the Delta variant appeared.
A current French study shows COVID outbreak in a nursing home where most residents are vaccinated. Several developed severe COVID. Another study showed an outbreak in a Kentucky nursing facility with a 90% vaccination rate.
An Israeli study shows “breakthrough” infections in the fully “vaccinated” can lead to long-haul symptoms.Nearly 20% of the fully “vaxxed” reported they had symptoms 6-weeks after diagnosis.
Israeli data also proves the advantage of natural immunity over “vaccination”. It also shows the death rate is higher among the “vaccinated” and infected as well as for death and hospitalization:
Out of more than 7,700 new cases just 72 were were in people infected naturally. That’s less than 1% of the new cases, which means reinfection for those with natural immunity amounts to 0.0086%.
By contrast, the vaccinated were 6.72 times more likely to get infected after the shot than after natural infection. 40% of new COVID patients were vaccinated.
The injections also waned early for the most vulnerable – the elderly.
This article on breakthrough cases in Massachusetts that resulted in death tries to diminish the fact that all these deaths were in fully “vaccinated” people.What the article refuses to admit is we’ve been told ad nauseam that these injections would prevent serious illness and death from COVID; however, the data does not support this claim.
This astutely written article methodically goes through all the numbers and proves that insidious misinformation is continually being used to promote the injections. It shows that the death rate of “vaccinated” people infected with COVID can be 3-5.7 times higher than in the unvaccinated.
Even a CNN medical analyst had to admit those who are “vaccinated” but had not previously caught COVID-19 are more susceptible to infection.
President Biden went so far as to state if you get the jab you won’t even get COVID.
Obviously, they are all wrong and need to state this, but they won’t.
A recent study published by King’s College in London, which operates the ZOE COVID Study app to monitor COVID infection and vaccination rates found an average of 15,537 new daily symptomatic cases COVID-19 among partly or fully vaccinated people in the United Kingdom—an increase of 40 percent from the previous week. Source
“Vaccinated” people account for 75% of coronavirus infections in Singapore
“Vaccinated” people account for 74% of infections in Cape Cod, Massachusetts.
Two major San Francisco hospitals reported 233 cases of COVID-19 in staff members – of which 80% were fully “vaccinated”
An expert states that 6% of all “break-through”cases result in death, and new data from the UK show:
FULLY VACCINATED PEOPLE ARE 65% MORE LIKELY TO BE HOSPITALIZED & 1540% MORE LIKELY TO DIE DUE TO COVID-19 THAN PEOPLE WHO ARE UNVACCINATED
This fact challenges manufacturer’s claims that the injections prevent death from COVID. The CDC has also used a ‘slight of hand’ by creating new guidelines on post-vaccination viral breakthrough cases by only recording cases involving hospitalizations and deaths, leaving the majority of symptomatic breakthrough cases of the virus unreported. So again, true numbers are going to be much, much higher.
CDC investigations have also found that the amount of virus present in vaccinated people is similar to the levels found in unvaccinated people, showing vaccinated people can easily transmit the virus.
THEY ARE ALSO HIDING THE NUMBER OF FULLY “VACCINATED” WHITE HOUSE STAFFERS WHO HAVE CONTRACTED COVID.
So the “vaccinated” can transmit the virus, become ill with COVID, and even die from COVID. Explain to me how this jab does anything at all besides make you feel good for the moment.
COVID shots are Bioweapons
Numerous experts including Dr. Fleming, a Cardiologist, Nuclear Cardiologist Certified in Positron Emission Tomography (PET) with a Juris Prudence Doctor of Law, who is a Researcher, Inventor, and Author states in his book, Is COVID-19 a Bioweapon? A Scientific and and Forensic Investigation states that these injections are nothing more than the genetic code of the COVID-19 bioweapon. This book traces the publication and money trail of COVID-19; showing who is ultimately criminally responsible for the design and development of this weapon, which violates the Biological Weapons Convention (BWC) Treaty, exposing those who have committed crimes against humanity. He also states that a “good” bioweapon doesn’t kill people but slowly demoralizes and harms them by causing “slow malicious diseases.”
See Dr. Fleming’s recent presentation which explains the difference between becoming infected with COVID vs. being infected with the “vaccine.” He explains how the spike protein in the injections is fundamentally different from the spike protein obtained through infection and that the prion-like domain (PLD) on the spike protein in the injections caused 95% of humanized mice to die within two weeks of getting the COVID shot. The bioweapon is a prion, not COVID. See Fleming’s website to learn more on how the virus is engineered with gain of function creating inflammo thrombotic response with mRNA reverse transcription into cell DNA with prion-like structures present in the virus spike protein.
Fleming isn’t alone.
Nobel Prize Winner Dr Luc Montagnier with numerous other scientists, states COVID has been manipulated and that components of HIV have been inserted into the viral sequence, perhaps in pursuit of an AIDS vaccine.
Dr. Lee Merrit, past president of the Association of American Physicians and Surgeons and member of America’s Frontline Doctors, states that COVID is the perfect binary weapon.
Dr. Mikovitz and Dr. Martin both discuss COVID as a bioweapon. The COVID-19 “vaccine” does not meet the legal definition of a “vaccine,” but it meets the legal definition of a “bioweapon.” Further, Dr. Mikovitz states at least 50 million Americans over the next few years will die due to COVID injections. That’s 15% of the population.
Karen Kingston (Pfizer whistleblower) confirms the COVID injections ARE BIOWEAPONS.
5 doctors state the injections are bioweapons. The injections cause YOU to manufacture spike proteins – perhaps indefinitely – the very thing causing illness.Those getting the shots are now transmitting this spike protein to the unvaccinated
The CDC as well as Israel are investigating cases of heart inflammation after COVID injections. Myocarditis has been linked to the influenza, tetanus, live virus smallpox, and the genetically engineered HPVvaccines.
Denmark and Norway have completely suspended use of the AstraZeneca experimental COVID-19 shots.
A statement issued by the Norwegian Institute of Public Health stated that the AstraZeneca COVID “vaccine” is more dangerous than COVID itself, especially for young people.
The EMA continues to recommend it. They did, however, add a safety warning to the J&J shots, due to fatal blood clots. (Source.)
The FDA is also now monitoring vaccine recipients for facial paralysis due to a potential safety signal in the clinical trial.
There is concern that COVID injection may not protect people with immune disorders.
Dentists, Optometrists, Podiatrists, and Veterinarians Can Now Administer COVID-19 injections. The Prep Act protects them from lawsuits if the injected person dies or is injured.
Mounting List of Adverse Reactions & Deaths
**While there is not definitive proof some of these were vaxxed, it is not normal to suddenly drop dead, and the timeline matches injection rollout. The COVID Blog, where I have obtained many of these deaths, is calling them #ABV or Anything But the “Vaccines”.*
Soccer player Christian Eriksen suffered cardiac arrest in 2021 and then collapsed four years later after another shot.
21 year old competitive body builder suffers with neurological problems, blood clotting disorders, POTS, dysautonomia, lost the ability to sweat & other debilitating symptoms that drastically altered his life after COVID shot.
Child dead after getting COVID booster in clinical trial but Moderna did not report it in any preprint, science journal, or even on clinicaltrials.gov, where companies legally must report trial results.
‘Wonder Woman’ actress who used her influence to get the COVID shots suffers massive blood clot in the brain requiring emergency surgery.
44 year old pilot collapses while jogging & dies suddenly.
South Carolina Rep suffers asthma, tremors, & heart pain following her 2nd COVID shot.
19 year old diagnosed with stage 4 melanoma which spread to brain and killed her.
32 year old nurse diagnosed with stage 4 turbo lung cancer which killed her.
41 year old instagram influencer dead 6 months after stage 4 turbo colon cancer diagnosis.
Australian author takes 3 years off work from ‘long COVID,’ dies suddenly.
64 year old Idaho man paralyzed 10 days after J&J shot. Go here for the many amputations.
40 year old Australian woman suffers medical episode crashing car into school, killing 11 year old.
16 year old diagnosed with peripheral T-cell lymphoma, which is considered old people cancer.
23 year old UNC football player dead from turbo lung cancer.
31 year old British soccer star found dead in swimming pool in Greece.
30 year old pilot mandated to get the shots to work dies suddenly.
22 year old fitness coach suffers sudden ‘widow maker’ heart attack.
38 year old vaxxed tennis legend who promoted the shots and called those who refused it ‘selfish’, Rafael Nadal, announces retirement due to “injuries” after admitting the difficulty of playing the past two years.
56 year old triathlete suffers organ failure, hematoma, and pulmonary embolism after shots.
42 year old fully ‘vaxxed’ X Factor star dies suddenly.
Australian journalist who ridiculed ‘vaccine’ safety activists, bullied parents challenging the vaccine schedule, and worked to ban group raising attention to adverse reactions, dies suddenly from turbo brain cancer.
Former CNN’s Chris Cuomo back tracks after initially stating he was injured by the COVID shot to stating he has ‘Long Covid” and is now taking ivermectin for it. He formerly ridiculed the unvaccinated and those taking ivermectin and spread misinformation.
53 year old gets headaches, then COVID, then can’t speak, swallow, or walk after 5th dose.
Woman gets bloodshot eyes, swollen face, can’t see or barely talk, has difficulty breathing, skin issues.
“Fully vaxxed” man with boosters, who wore masks and social distanced, blames long COVID for immune system failure.
60 year old British actor, Adrian Schiller, dies suddenly.
17 year old Michigan girl required to get two COVID shot doses by the Odd Fellows Organization to go on a trip gets COVID, goes into cardiac arrest three times requiring life support and ventilation, develops multi-organ failure and ultimately dies.
Wales mandead from cancer in arm that received COVID shots and booster.
75 year old UK’s King Charles diagnosed with prostate cancer.
Duchess of York, Sarah Ferguson diagnosed with malignant melanoma and breast cancer.
Previously healthy 21 year old develops rash, pain, coughs up blood, pulmonary embolism, blood clots, and thrombocytopenia throughout his lungs after two shots.
Pro-vax Rod Stewart who brands anti-vaxxers as “killers,” reveals 11 year old son rushed to hospital after collapsing of a suspected heart attack while playing soccer.
41 year old Slovakian actress develops incurable neurological disorder after work-mandated J&J booster shot, dies by assisted suicide.
66 year old fully “vaxxed” NY woman gets chilblains in toes, hair loss, EBV, parvovirus, liver damage, & rotting front teeth.Blames COVID.
55 year old actor Jamie Fox, mandated to get the jab by Netflix, is hospitalized with a blood clot in the brain and is now “partially paralyzed and blind.”
28 year old pro-basketball player Óscar Cabrera Adames died during a stress test. In 12/21, he collapsed on the court during a game and blamed the incident on “vaccine”-induced myocarditis.
Houston, TX rap legend BIG POKEY collapses and dies on stage.
Zak Herbstreit, junior tight end at Ohio State and son of Kirk Herbstreit, ESPN football analyst, has been hospitalized, cause unspecified.
Featherweight Bellator star Cris Lencioni suffers cardiac arrest while training.
Iago Garay suffers brain aneurysm at Pietra Ligure requiring two surgeries.
PGA Commissioner Jay Monahan going on medical leave due to a “medical condition.” #ABV
8 time NFL-Pro Bowler, Deion Sanders, facing potential foot amputation after already having two toes amputated due to blood clots. #ABV
In memory of those who “died suddenly” in the US (June 12-19, 2023).
In memory of those who “died suddenly” in Canada (June 12-19, 2023).
42 year old ESPN director Kyle Brown dies suddenly.ESPN’s parent company, Walt Disney, required all salaried and nonunion hourly employees to get the clot shot. Walt Disney then made the shots mandatory for staffers at live events at the beginning of August and then expanded it to ALL employees.
60 year old Australia disc jockey who calls the unvaxxed “belligerently stupid,”dead 30 days after his 5th jab.
63 year old journalist who states vaxx-injured people are faking it is now perpetually sick & her partner dies from hyper-aggressive post-shot cancer.
Up to April 23, 202316,000 Americans report suffering from tinnitus after COVID shots.
Nine patients in Turkey develop skin diseases within 15 days of COVID shots.
67 year old Iranian man develops fever, erythema patches & bullous lesions & elevated D-Dimer levels.
62 year old patient with preexisting psoriasis develops blisters, psoriasis flare, & bullous pemphigoid.
12 year old Louisiana boy collapses and dies at school.
50 year old British man dies in his sleep from pulmonary embolism.
46 year old Utah woman dies suddenly from ruptured brain aneurysm.
56 year old grandma was told by her daughter she needed the jab to see her grandchild. Now she is diagnosed with Raynaud’s disease, paresthesia bursitis, a microembolism, peripheral neuropathy, small fiber neuropath and other conditions after COVID shots.
36 year old top female Aussie wrestler, Kristen Mitchell, dies suddenly.
50 year old healthy surgeon contracts Transverse Myelitis 7 days after COVID shot. Now unemployed.
32 year old ‘healthy and fit’ clinical psychologist dead 10 days after AstraZeneca shot.
CA meteorologist’s eyes roll back and she faints on live TV necessitating a hospital stay.
55 year old ‘General Hospital’ head nurse actress dies suddenly.
67 year old British comedian and TV star Paul O’Grady dies suddenly.
27 year old Bokito the gorilla dies from heart failure. Countries have been injecting zoo animals with the mRNA gene therapy injections, and now there is concerted effort to get it into our food supply. The Chinese have already put it in milk and successfully immunized mice in an experiment.
Australian woman discusses severe reactions after COVID shots. Hospitalized for a week, now wheelchair bound and has protruding veins. Labs looked normal and it took a long time to determine it was the COVID injections.
14 year old Japanese girl dies 2 days after 3rd Pfizer shot. Post-“vaccination” pneumonia, myopericarditis, hepatitis, nephritis, gastroenteritis, cystitis, and myositis.
23 year old Philadelphia man develops daily tremors, muscle spasms, involuntary vocalizations and temporary paralysis after 2nd shot.
19 year old Indian man collapses and dies while dancing at a wedding reception.
21 year old N. Carolina student is the 9th death at the school since Sept. The school has a “vaccine” mandate. MSM hoping “suicide” narrative distracts from the clot shots.
13 year old Canadian boy dies suddenly while on vacation in Mexico.
13 year old Georgia girl dies suddenly after sudden internal bleeding from all organs.
49 year old Michigan firefighter collapses and dies on scene of a fire.
21 year old Missouri College athlete dies suddenly.
1 year old UK child dies from suspected cardiac arrest.
18 year old high school student from Nevada dies from cardiac arrest.
In Telangana, India a string of cardiac arrests have popped up in the past few weeks.
20 year old fully vaxxed and boosted Florida model gets COVID, then is diagnosed with myocarditis. rhabdomyolysis, mild pneumonia, cyanosis, acidosis, & blood clots resulting in a double amputation. MSM blames COVID.
Young Taiwanese girl dies from myocarditis after Pfizer shot. Awarded NT$3.5 million (US $114,000) from the VICP.
20 year old London woman collapses and dies suddenly in her father’s arms.
50 year old former athlete dies from a heart attack.
31 year old former Mets minor league pitcher Matt Pobereyko dies from sudden heart attack.
42 year old former US swim champ Jamie Cail dies suddenly.
Florida woman finally out of ICU after 47 days after a cardiac arrest which caused brain seizures.
28 year old actor Jansen Panettiere dies suddenly.
37 year old surgical tech and mother of 3 now an invalid after COVID shot
28 year old Bangladeshi man develops myocarditis after COVID shot then dies 21 days later.
7 year old who was triple vaxxed suddenly dies after catastrophic brain event that indicates ruptured brain aneurysm, post-injection meningitis or encephalitis.
Actor Tom Sizemore in critical condition in ICU after suffering brain aneurysm.
20 year old Nigerian soccer player collapses and dies on the pitch during a match.
21 year old basketball player from Greece dies suddenly from a heart attack.
8 year old girl dead after suffering excruciating pain from post injection vasculitis. Parents blocked on FB after warning others.
Kim Pegula, Buffalo Bills owner, suffered a cardiac arrest and spent several months in the hospital due to brain damage. She issued a “vaccine” mandate for all fans entering Highmark Stadium.
67 year old Bills radio announcer John Murphy suffers a stroke. No update on his condition.
43 year old USTA healthy tennis champion collapses and dies on court.
45 year old actress dies of “cancer” she developed in 2020.
44 year old Thai princess collapses & goes into a coma from a “bacterial infection.” BBC states it’s a “heart condition,”the Asian Sentinal states she died suddenly from a brain aneurysm.
25 year old former NFL player, Jessie Lemonier, dies suddenly.
53 year old Canadian woman develops body-wide itchy rash, swollen eyelids, fluctuating heart rate, extreme fatigue, leg cramps, slurred speech, brain zaps, unable to swallow food, muscles atrophying, lack of balance, swollen tongue, can no longer work, but is getting no help – only gaslit by doctors and officials.
Elon Musk states he had major side effects after his second booster shot and felt like he was “dying for several days.”
Guard at Westminster Hall in London in front of Queen’s coffin collapses on live TV.MSM live stream cut off for 8 minutes before returning, then normalizes collapse by blaming 6-hour shifts of standing.
36 year old Vietnamese woman gets gruesome skin reaction after two AstraZeneca shots.
34 year old British man collapses and dies during charity soccer game.
40 year old U.S. Army soldier dies of “natural causes” while overseas
17 year old Florida student dies suddenly while playing golf.
25 year old “transgender drag queen” drops dead while dancing.
31 year old former “American Idol” contestant dies suddenly of a cardiac arrest.
54 year old Lisa Maria Presley dies suddenly of cardiac arrest. She falsely believed her vaccination was protecting others.
Superfit sport physiotherapy consultant diagnosed with ventricular tachycardia, pericarditis, blood clots, memory issues, &shooting pains, after second AstraZeneca shot but is gaslit by nurses accusing him of just wanting drugs.
17 year old Las Vegas teen dies suddenly from cardiac arrest.
42 year old former Alabama Crimson Tide running back Ahmaad Galloway dies suddenly.
55 documented cases of performers collapsing, dying, or suddenly falling ill in late 2022-2023.
21 year old Air Force Academy football player collapses and dies suddenly while walking to class.
18 year old MMA fighter, Victoria Lee dies suddenly.
22 year old military member hospitalized 9X after COVID shot.
58 year old sister of media personality Megyn Kelly dies suddenly from a heart attack.
Mississippi State University head coachdies from a “heart attack.”
54 year old ‘Eight is Enough’ star Adam rich dies suddenly.
16 year old student collapses and dies suddenly during a flag football game.
17 year old Wyoming basketball player dies suddenly.
26 year old son of WWE legend Kevin Nash dies suddenly.
NCAA player Imo Essien collapses on the court clutching his chest.
51 year old Ineitha Lynnette Hardaway of Diamond and Silk dies suddenly.
Three active-duty Mass. law enforcement officers mandated to get the shotdied suddenly within 7 days of each other.
29 year old gets skin blisters on one hand after first shot which then covers his whole body with burning after 2nd shot.
38 year old former NFL player who had COVID twice but still got the shot, dies suddenly. He wanted to jail the unvaxxed for being selfish and was a supporter of “vaccine” mandates and passports. The unvaccinated are not the problem.
Pilot Patrick Ford pronounced dead after emergency landing (American Eagle flight 3556)
Cabin Crew member Yasser Saleh suffers heart attack & is declared dead.
45 year old first female pilot of Seychelles dies suddenly.
60 year old quadruple-vaxxed Canadian homeless advocate dead 8 days after 4th shot.
66 year old fully “vaxxed” Florida man who calls nonvaxxed “political a*sholes”diagnosed with POTS.
65 year old fully vaxxed woman first diagnosed with POTS, dies suddenly.
Australian physician dies suddenly. He told mothers of two girls who suffered immediate convulsions after the COVID shot that they were fine and that it had nothing to do with the shots despite it happening within minutes.
48 year old vaxxed American sports journalist collapses and dies at World Cup.
16 year old Minnesota hockey player suffers multiple strokes then dies on Christmas Day.
18 year old rodeo cowboy falls deathly ill during competition. Dead one week later.
35 year old Canadian bureaucrat dies suddenly. (Canada has had a “vaccine” mandate for federal workers since 2021)
52 year old “Fully vaxxed” British caregiver dies suddenly.
15 year old British girl collapses and dies at school.
60 year old CNN vax zealot reporter dies suddenly. MSM blames cancer.
71 year old California college instructor, studio exec collapses and dies at gym.
47 year old British man collapses and dies on his way to work.
18 year old selected number-1 overall Canadian hockey player dead.MSM blames suicide.
Baby dies of blood clots after hospital performs vaxxed blood transfusion against parents’ wishes. The hospital “lost” the unvaxxed blood donated by a friend.
Top virologist, Dr. Oveta Fuller who advocated for EUA of 3 COVID shots, dies suddenly.
46 year old mother of two went into a coma for 4 days, is diagnosed with Guillain-Barré, and spends her days in utter pain.
Fully vaxxed mom of 2 dies in her sleep hours after testing positive for COVID. She only had a runny nose & sore throat
18 year old British hockey player collapses and dies in a barn
Indian mandies suddenly of heart attack, wife dies four hour later of heart attack
24 year old Florida woman dies suddenly aboard yacht
61 year old Indian business man collapses and dies on camera at dental office of heart attack
35 year old Africa TV and radio broadcaster dies in her sleep
62 year old West Virginia woman dies unexpectedly of heart issues
“vaxxed” Brittany Spears suffers miscarriage, and is diagnosed with permanent nerve damage on the right side of her body and has numb hands, and a body-wide “pins and needles” feeling
21 year old Mississippi college student dies suddenly.Jackson State University has a vaccine mandate
46 year old India actor and model collapses and dies while working out
53 year old hygienist dead 5 weeks after booster shot
4 year old Argentina boy who starred in a national “vaccine” campaign dies suddenly
AstraZeneca-vaxxed Canadian attorneycollapses during “FreedomConvoy inquest
15 year old vaxxed teen commits suicide after relentless bullying for false rumor of being nonvaccinated
41 year old Utah woman dies unexpectedly in her sleep.
38 year old NH doctor & Dartmouth professor (had a vax mandate) dies suddenly.
25 year old CA musician (attended France’s film festival with a vax mandate) gets stage 3 germ cancer and dies.
25 year old MN hair stylist attending Herzing University (has vax mandate)suddenly dies.
18 year old vaxxed TX woman dies suddenly after booster shot.
38 year old NFL (had a vax mandate) assistant coach dies suddenly.
7 year old Kentucky boy dead from “sudden illness.”
41 year old Missouri teacher collapses and dies while riding a bike.
40 year old vaxxed Washington State volleyball coach dies unexpectedly.
18 year old Arkansas cheerleader dies suddenly from pulmonary embolism.
37 year old CA (vax mandate for all teachers) coach and teacher dies unexpectedly.
27 year old vaxxed doctor and lawyer collapses and dies of heart attack.
11 year old Argentina boy collapses and dies while playing soccer.
Canadian woman drops dead after getting the booster at Saskatoon Shoppers Drug Mart. While someone witnessed it,coroner states it’s due to “natural” causes.
News Anchor from KJRH-TV, which required all employees to be fully “vaxxed”, suffers stroke on air, spends 2 days in the hospital, and will be off air for several weeks.
Hollywood makeup artist dead 9 days after getting monkeypox vaccine.
20 year old Canadian junior hockey player collapsed and died during preseason game.
Brown University student forced to get the vax hospitalized with what appears to be myocarditis.
37 year old mountain biker died in his sleep just two days after winning Scottish championship.
Mother forced to get jab due to needing a possible C-section in hospital now has a hospitalized baby needing a brain scan, and who is constantly shaking and in pain.
Formerly healthy mother has 3 visits to the ER and neurological exam for 2 days in hospital – now has uncontrollable shaking with no diagnosis or follow-up from CDC/FDA or VAERS.
Mother has red, raw, swollen body & rashes after shot. The steroids she was given make her suicidal, aggressive, and out of character. On suicide watch.
Mother of four develops shortness of breath, heart palpitations, and 3 abnormal EKGs, but doctor blames anxiety. Finally diagnosed with pericarditus, a known side-effect.
Once healthy mother spasms uncontrollably after J&J shot. Also has headaches, neck pain, nausea, tremors, difficulty swallowing, speaking, and can only walk with assistance.
Japanese womanloses all her hair (alopecia) within days of COVID shot.
Philippino flight attendant suffers severe asthma which led to cardiac arrest and brain hypoxia.
6 year old Mexican boy faces multiple amputations (hands, feet, and ears).
Ukranian woman suffers with swollen legs and fluid everywhere. Must take unpleasant cholesterol lowering drugs and inject her stomach to prevent blood clots. Biopsy shows membranous nephropathy.
Woman gets pericarditis after shot and can no longer take care of daughter or work.
Woman suffers from dysautonomia(tremors, fainting, tics, brain fog, memory loss) as well as nausea, fatigue, pain in wrist and hand that got the shot, heart & blood pressure issues, & speech problems.
Two friendsdie three weeks apart. One of a ruptured brain aneurysm and th eother from a “medical emergency.” Both were CA healthcare workers mandated to get the shots.
42 year old triple-vaxxed Irish law professor dead.
43 year old man found at home in advanced state of decomposition due to thrombosis that caused an ischemic stroke & internal bleeding following Pfizer jab
Previously healthy man gets arm amputated, congestive heart failure, a blood clot in the heart, double pnuemonia, and he may need his legs amputated also due to blood clots.
Healthy 12 year olddead from heart attack after the injection.
Woman suffers from abnormal T2 signal, abnormal head-up tilt table test, develops autonomic dysfunction, Meniere’s disease, vertigo, cervical dysfunction, 12 days after Pfizer shot.
Young girl’s kidneys shut down, has internal bleeding, dead.
Young woman who had her eczema under control breaks out worse and worse with painful eczema with each COVID shot
38 year old woman’s hair falls out, is hospitalized and intubated 5 times, suffers uncontrollable movement, & muscle spasms, now diagnosed with progressive neurological disease
36 year old TikTok star dead after hearing voices in her head.
Texas mom found dead in car weeks after being reported as missing. #ABV
Woman develops seizures, uncontrollable spasms, irregular heart rate, rashes, and requires a walker.
Woman gets shot to see grandparents, but now hates herself for it due to side-effects. Couldn’t see grandparents anyway due to health guidelines.
Woman gets body-wide rash and sores two days after second dose.
Young man gets arrhythmia, chest pains, rapid heartbeat, high blood pressure, fatigue, blisters, fainting and dizziness, lack of feeling in hands.
Woman forced to get jab for her job convulsed for two full days. Swollen tongue, blurry vision, metalic taste, 3-7 convulsions daily, involuntary body movements, high heart rate, can’t focus.
Teacher coerced to get jab to keep job got body-wide rashes & is hospitalized.
Woman has chest pains, random dizziness, cold chills, pins and needles through body, heart palpitations, fatigue, inflammation, nerve damage and shaking after shot but was told it’s anxiety.
Two Ontario brothers who got the boosters together, die suddenly and unexpectedly of heart attacks
North Carolina woman (fully vaxxed) suffers post-shot blood clots, amputations, surgeries, ventilators but blames COVID.
Canadian woman gets post-injection autoimmune issues (relapse-remitting MS) & a rash but repeats the lie that it would have been worse if she wasn’t “vaxxed”
25 year old Norwegian beauty entrepreneur suffers menstrual bleeding everyday for a year since her 2nd Pfizer shot.
39 year old narrowly escapes amputation after Turkish doctors pull several 4 inch long blood clots out of his leg. Got the J&J shot to travel.
Woman gets seizures & shaking after shot. Can no longer work or drive.
48 year old caregiver coerced into shot suffered metalic taste in mouth and swollen tongue. Now has two day long seizures. Can’t work.
Formerly fit man who climbed mountains now can’t ride his bike for 10 min after shot.
Air Force Major suffers heart inflammation, tinnitus, brain fog, myalgia, bruising, and other symptoms after coerced COVID shot
At least 58 infants had life-threatening side efects after shots.
2 month old suffers cardiac arrest one hour after shot.
27 babies suffer “neuroleptic malignant syndrome” a life-threatening reaction like those who react to antipsychotic drugs which causes high fever, muscle stiffness, altered mental status, excessive sweating & saliva, wide swings in blood pressure, and dysautonomia after COVID shot.
8 year oldhallucinates, feels like bugs are crawling on her, is suicidal after shot
“Vaxxed” Guitarist found unconscious, taken to hospital where he was intubated & in a coma for 3 weeks. Blood clots shut down his kidneys & other organs leading to 8 fingers being amputated
12 more “sudden and unexpected” deaths (including a Stevens Point, Wisconsin 15 year old)
36 year old YouTuber gets post-injection ovarian cancer diagnosis
32 year old Pennsylvania woman develops POTS, chronic nerve, muscle, joint & jaw pain with neck stiffness
59 year old New Yorker goes to ER due to leg numbness, and now has peripheral neuropathy with tingling and rashes and bruising
43 year old Spaniard develops headache, dizziness, pain in eyes, earaches, sensitiveity to light, extreme fatigue, insomnia, head zapping, pain and numbness in legs, chest palpitations, breathlessness, pins & needles sensation, and anxiety
Santa Fe woman develops hair loss, heart palpitations, involuntary muscle movement, pain, & insomnia
48 year old Floridian gets arm pain, swelling around eyes, debilitating headache, dizziness, & fatigue, brain fog, short-term memory issues, neck pain, pins & needles sensations
37 year old Canadian woman has anaphylactic reaction within 10 min of shot, full blown hives, cough, tongue, face, and neck swelling. Now suffers daily anaphylactic mast-cell attacks that require epinephrine
Young woman diagnosed with Lupus after shot. (Bruises all over body, joint and chest pain, sun and light sensitivity, extreme fatigue, hair loss, and various rashes)
Irish woman experiences bruising, loss of vision, pain, and facial paralysis after jab. Doctors gave her a diagnosis that is incurable & refractory. She has filed a criminal complaint & now runs a support group for those similarly affected.
Teenager required to get jab to stay on sports team suffers neurological damage, faints, shakes uncontrollably, visits ER. Uncertain future.
16 year old experiences stabbing pain under rib cage & nausea, but doctors take out a perfectly health appendex. Develops severe tics – lasting 4 hours, passes out from exhaustion. Light and noise sensativities, memory loss, legs collapse.
Woman experiences “normal” side effects until she developed severe neck pain, and tingling and numbness on her left side & limited mobility after Pfizer jab.
38 year old Ontario woman develops blood clots, convulsions, fatigue, burning veins, pain, and neurological issues after Pfizer jab.
Indiana woman develops Guillian-Barre & paralyzed after COVID jab. In rehab now.
Brazilian girl suffers stroke after shot and is relearning how to walk after COVID shot.
German news report on woman requiring emergency operation due to thrombosis in the brain.
Young man from Germany hospitalized with heart muscle inflammation after shot.
German woman with heart muscle inflammation after shot.
41 year old Arkansas woman gets swollen lips, tightness in throat, rashes, body pain and an autoimmune disease after two shots of Pfizer.
Formerly healthy man forced to get jab to keep job, hospitalized for pneumonia & still suffering a year later from nausea, chronic fatigue, and headaches. Diagnosed with gastroparesis & pitutary disorder.
Woman vaxxed at grocery store hospitalized with heart attack and blood clots in lungs.
Canadian care worker forced to get jab to keep job suffers muscle cramps, convulsions, temporary blindness, heart palpitations, shortness of breath, & depression after shot.
26 year old man suffers uncontrollable convulsions after Moderna shot.
ESPN analyst not able to cover NFL draft due to blood clot.
47 year old Canadian woman goes to ER twice and struggles with severe pain.
Autopsy reveals deathdue to COVID shots/booster. Daughter develops itchy rash for 3 weeks that her doctor states was due to ‘vaccine’ shedding from her father.
Woman gets severe swelling around eyes, & multiple rashes after jab.
8 year old gets enlarged heart, continual seizures, after Pfizer shot and sent to psych ward after being accused of doing drugs.
Ontario student dismissed by doctors after getting chest pains after Pfizer jab. Due to not getting 2nd dose, she is not allowed to enter the University campus.
38 year old “vaxxed” editor at USA Today has heart attack & is found dead on his couch
3 more athletes collapse and die (heart attacks, brain bleeds, cardiorespiratory arrest, etc.)
59 year old banking regulator dead after Pfizer jabs.
33 year old, previously physically active, healthy woman now has involuntary muscle contractions, weakness, shaking, and can barely walk after shot.
24 yeardead of sudden ruptured brain aneurysm –also had injection site, muscle, & back pain.
Womancan’t feel lower part of her face including her teeth after shot. Doctors brush her off.
World champion inline skaterfeels faint,numbness in teeth & cheeks, headaches, tingling arms, eye-balls hurt & blurred vision, & shortness of breath. Couldn’t walk or talk & had a stroke.
South African media personality, Kuli Roberts, dead after Pfizer jab.
Woman develops painful body-wide rash. Can’t do normal functions & hardly gets out of bed.
Thousands of women reporting mentrual side-effects(missed periods, more bleeding, pain)
26 year olddead of myocarditis. Autopsy found COVID shot a contributing factor.He had successfully recovered from reversing a brain aneurysm and had “a healthy, strong heart,” based on echocardiograms conducted before his surgeries.
22 year old forced to get jab to keep job, gets blood clot which caused severe pain in arm.
Woman disabled after COVID shot. Suffered from black outs. Hospitalized for 4 days.
8 year old develops post-injection neurological disorder & struggles to walk and talk.
5 year old Filipino girl hospitalized and on life support less than 13 hours after shot.
54 year old triple-vaxxed Australian TV personality blames “long COVID” for her pericarditis and deteriorating health.
7 more “vaxxed” young people die suddenly and unexpectedly.
US military personnel continue to suddenly and unexpectedly die as mainstream media blame suicides. Fort Bragg has stopped releasing details of deaths.
42 year old quadruple-vaxxed Canadian ER doc sick with COVID & admits all docs in his department who got COVID were triple-vaxxed. Abruptly disappears from Twitter.
44 year old diagnosed with aggressive post-injection brain cancer. Dead 3 weeks later.
Within minutes of shot, woman can hardly walk, suffers with weakness, tremors, headaches, and pain.
Frontline worker in Singapore lost feeling in her legs. Still struggling neurologically a year later. Doctors blame her DNA.
Previously healthy man forced to get jab to keep job now has myocarditis. Has chest pain, shortness of breath, brain fog, high troponin level. Cardiologist got him a vaccine exemption but due to his company’s ‘vaccine’ mandate he was stood down without pay. Must keep heart rate low. He also tested positive for COVID even after shot.
Pilot forced to get jab to keep job, passes out and suffers a heart attackminutes after landing the plane. Will probably never be able to fly again.
Previously healthy woman develops heart inflammation, numbness, seizures, and high blood pressure after Moderna shot.
23 year old drops dead at work after 2nd shot. Coroner finds an enlarged heart.
Woman gets racing heart rate, trouble breathing, & dizziness after shot. Symptoms worsened requiring a trip to the hospital.
Woman gets shot to travel but now has a painful lump on arm. Can’t sleep on her side now.
Young woman has severe head pain after shot. ER gave her no treatment & said she was fine.
57 year old Scottish man has leg amputated due to blood clots after shot. This is not rare.
Hour long video of COVID shot effects. People dropping and spasming uncontrollably.
8 minute video by The American Journal showing people with adverse neurological, pulmonary side effects, such as spasms, seizures and lung clots.
4 cases of erythema multiforme (EM) within 10 days of Pfizer shots (rashes and lesions in mouth, face, and body)
Previously healthy Danny Hubbard needs round the clock care. Can’t open left eye or speak, has 24/7 muscle jerks, tremors, and seizures after jab.
Woman who used to debunk vax reactions ends up in hospital with severe heart issues
27 year old Italian pro swimmer dies suddenly and unexpectedly of a heart attack.
56 year old fully vaxxed NY cop dies after getting jaundice, liver problems including blockage and scar tissue requiring a biopsy.
Fully vaxxed and boosted comedian dead from heart issues.
Doctor profusely vomits after COVID shot, was put on the ventilator four times due to an inability to breathe, had nausea, dizziness, heart palpitations, put on blood thinners, had abdominal distention, GI bleed, & collapsing vocal cords.
Champion shooter admitted to hospital for Guillian-Barre syndrome 10 days after shot. She was paralyzed from head to toe, & couldn’t swallow.
Fully vaxxed and boosted man now has hives and extreme skin sensitivity.
Fuly vaxxed woman taken to ER for symptoms of heart attack and blood clots.
22 year old Utah woman with 6 pre-existing conditions required to get jab for heart transplant suffers skin reaction, (painful blistering) needs oxygen to breathe
Fully vaxxed 54 year old free-lance journalist dead. His hatred of the unvaxxed is palpable.
Son describes the Creutzfeldt-Jakob Disease (CJD like mad cow disease) that took his mom’s life after her second shot. (Fixed eyes, howling, non-stop violent tremors, couldn’t walk or feed self)
Canadian woman still suffers severe debilitating neurological symptoms a year after shot.
Man gets fever, chest pains, shortness of breath & is diagnosed with pericarditis.
16-year-old Australian now crippled with convulsions, persistent nausea and visible tics. Health officials admit “there is no question Faith has had a delayed reaction to the second Pfizer vaccination”.
34 year old UK mother dead from catastrophic brain bleed 9 days after shot. Doctors ruled it was “vaccine” induced thrombotic thrombocytopenia (VITT)
31 year old UK father dead from “vaccine”-induced brain hemorrhage
Formerly healthy mom gets uncontrollable tremors, can’t hold a pen, drive, or walk, after jab.
Caretaker who got jab to save job now has body-wide tremors and is unable to do her job.
52 Australian cricket icon tells world to “get vaccinated & learn to live with it,” suffers heart attack and dies.
Young man paralyzed from the waist down 12 days after J&J shot. Neurologist concerned it’s a myelinic form of post-vaccinal acute disseminated encephalomyelitis (ADEM).
Director of Mayo Clinic’s Vaccine Research Group develops life-altering tinnitus. He states millions globally could also be suffering the same fate.
52 year old woman dead from “vaccine” induced thrombocytopenia (blood clots) from J&J shot. ‘Powers that be’ still state it’s “rare.” Scroll through and determine for yourself just how rare blood clots are, with what I now label “clot-shots.”
Pilot gets brain swelling, tunnel vision, & 6 spinal taps after jab. Can never fly again.
Nurse and mother couldn’t lift her arm for 3 days, developed fatigue, severe pain in her elbows, knees, and ankles, got shingles and sharp pains in her chest, legs, and back, blurred vision, numbness, burning sensations, involuntary muscle jerking, tingling, lost neck function, memory loss, throat tightness, and internal vibrations.
2nd year pre-med student suffers nausea & vomiting hours after Pfizer jab. Next came back pain, severe rash, blood in his urine, and a 3 month hospital stay. He developed cataracts and tinnitus that progressed to deafness and kidney failure.
Woman with epilepsy, which was in remission, and other autoimmune disorders, gets epilepsy back after COVID shot.
52 year old woman dead after J&J shot. (Blood clotting disorder)
Woman loses ability to talk or walk normally, clean, cook, or hold her baby, yet doctors gaslight her and deny the link to the injections.
Man suffers near blindness & detached retina when a vein burst in his eye. He was denied an exemption from further COVID shots.
Within 10 minutes of jab, woman can barely move legs and needs a walker. Nonstop headaches, nausea, and other serious problems.
Highschooler suffers fevers, vomiting, headache, stroke (brain bleed & blood clots), coma, after J&J shot. Now wheelchair bound.
Woman goes to the ER 30 times (code stroke symptoms) after Pfizer jab. Suffering severe neurological issues.
Woman suffers severe allergy after 2nd Pfizer jab. Hives, fatigue, hair loss, no energy, and is very sick.
Minnesota Representative dead after fighting a battle with kidney cancer, was “vaccinated” and also got COVID.
39 year old Brazilian woman gets blood clots, has leg amputated 15 days after shot.
34 year old Canadian man collapses & dies in front of his children.
36 year old CA Sheriff’s deputy dies unexpectedly after heart attack.
Canadian man spends 10 days in hospital to treat post mRNA shot heart attack.
Woman felt “weird” & delirious after COVID shot blacked out and began seizing, was intubated, and struggled with fear and anxiety.
Woman states her body was magnetized after 2nd COVID shot. She developed GBS, postural orthostatic tachycardia syndrome and pericarditis. She states VAERS is a bust with only 50 employees involved.
Two Young mothers lose babies after COVID shots. One baby developed severe blood clot and brain bleeding.
Comedienne Chelsea Handler’s comedy tour “Vaccinated and Horny” is cancelled due to a “health scare.” She admits the first shot made her deaf in one earand that she “feels sick.”
49 year old Australian radio and TV personality gets shingles, a common and well documented adverse reaction two months after booster.
Former pro football player dead 5 days after booster shot.
Ballgirl at Australian Open collapses on court during match.
Woman develops 3 lumps on her head following first COVID shot. Doctor tells her not to take any more shots, as they will soon be halted globally due to new info not avail. to the public.
Female Olympic athlete diagnosed with pericarditis after booster shot.
Punk icon put in induced coma 1 month after COVID booster. Has bleeding in the brain.
6 year old boy from Portugal dead from cardiac arrest after first Pfizer shot.
10 year old Brazilian girl suffers cardiac arrest 12 hours after first Pfizer shot.
6 year old MN boy develops myocarditis, can’t eat on his own or swallow saliva.
Comedian collapses on stage immediately after bragging, “I’m vaxxed, doubled vaxxed, boosted….” Spokesperson blames dehydration, resulting in a skull fracture. She appears on Ask Dr. Drew who told her his friend was destroyed by the booster and can’t walk.
8 days after man was forced to get jab to keep job, he had a basil ganglia hemorrhagic stroke which left him unable to walk or use his left arm.Employer refuses to cover medical costs.
Dr. Neil Singh Dhalla dead 4 days after getting COVID booster. Autopsy said myocarditis.
Toronto father tells board members his 17 year old son, forced to get vaxxed to play hockey, developed a rash, went to the hospital – sent home with Advil. Mom found him dead on the floor.
Healthy Louisiana man develops autoimmune disease, then dies after 2nd COVID shot. Doctors agree that the COVID “vaccine” caused an immune response that led to the development of the autoimmune disease.
Ontario woman develops POTS and dysautonomia, and is unemployed after Moderna shot.
53 year old triple vaxxed Manitoba teacher dead after “sudden intense illness.” Media blame COVID.
Australian epidemiologist and WHO adviser who called unvaxxed “self-centered” got severe headaches. Diagnosed with a cancerous brain tumor.
70 year old that stated, “get the vaccine, not dewormer,”dead 10 weeks after Moderna booster.
COVID jab victims talk about the health horrors they’ve suffered since they took COVID shots — the safety of which is actually still unknown. “Don’t get this poison,” ~ jab victim
Wheelchair bound Australian woman gets heart palpitations, aches, fever, chest pains, breathing difficulty. Diagnosed with pericarditis.
Prince Edward Island woman gets Pfizer shot and within minutes has a metallic taste in her mouth, gets dizzy (fell & broke her nose), nauseous, couldn’t swallow, arm numbness & pain, headaches, brain fog & spaciness, was able to get an exemption.
46 year old Canadian woman gets severeBell’s Palsy, tonsil stones, and had to get a feeding tube for 18 days in hospital & it’s only getting worse. She states, “I hear there is over 200 of us.”
Mother warns others about breastfeeding after COVID shots. Son got body wide rash.
Girl shakes uncontrollably & can’t hold up her head. Doctor said,“there is no point in doing any more tests.”
17 year old athlete hospitalized for 9 days with clot in jugular vein and 2 brain blood clots
43 year old CBC radio host dead after post-Moderna “serious illness”
Spanish basketball player collapses & convulses on court
49 year old Wall Street Journal & NY Times Writer dead hours after jab.
40 year old French man gets chest pain & shortness of breath after jab. Diagnosed with post-injection pericarditis.
22 year old college student suffers 94-straight days of vaginal bleeding after Moderna shot.
24 year old missionary & numerous othersdead after church policy mandates jabs for those traveling outside their own country. (See link for LDS church stock holdings in J&J, Apple, Microsoft, Google, Amazon, Facebook, and more. It owns $81 million in Pfizer.)
Covidblog receiving 2-3 emails per day reporting deaths and maimings since “vaccine” mandate went into effect in the Philippines. Their President not only mandated that all non-vaxxed people stay-at-home indefinitely, but also ordered police to arrest any non-vaxxed person who violates the order.
American actor & comedian Bob Saget dead one month after COVID booster shot.
14 year old Israeli American girl dead from heart attack after COVID shot.
28 year old Brazilian singer dead 6 weeks after jab. (pulmonary embolism)
Brazilian TV personality suffers cardiac arrest during live broadcast 1 week after COVID jab.
25 year old Guatemalan football player dead after heart attack.
Triple ‘vaxxed’ healthy Swiss marathon record holder & Olympic athlete gets myocarditis after booster shot. Now unable to compete.
Fully ‘vaxxed’ tennis star forced to quit game after chest pain & breathing difficulties.
Double ‘vaxxed’ healthy 23-year-old healthy scientist, & power lifter champion, died after testing positive for Covid-19.
NY Times editor dead of heart attack one day after booster shot.
Social Media Influencer gets Bell’s Palsy after COVID jab.
Previously healthy Canadian girl in wheelchair after Pfizer (Electric shocks & numbness in legs)
Dancer Maxwell Harris diagnosed with pericarditis after jabs. No exercise for a year, & uncertain future.
Woman forced to get COVID jab for her job now without job – needs a walker and help to do basic personal tasks, but is not permitted an exemption for the 2nd shot nor compensation. Ignored by MSM.
Formerly healthy 19 year old Australian vomiting, fever, shaking, sore joints, blurred vision, headache, pain all over after 2nd Pfizer jab. D-dimer test positive, rushed to the ER – has blood clots body-wide including her lungs, chest, and lungs. Back in ER with chest pain.
News video shows death & adverse effects from around the world.
80 year old gets bruises, black blisters, and shakes, spending 17 days in the hospital with brain bleeding & a platelet count of zero. Now needs 20 pills a day to survive.
Healthy 33 year old New Zealand nurse gets pericarditis after 2nd shot & is seventh person admitted that day with heart problems after shot.
Australian tennis player Pat Cash states doctors convinced his 89-year-old mother to get the COVID-19 injection which resulted in days of headaches, two strokes, and a heart attack. Nothing was reported. 32 Canadian doctors fully “vaccinated” die suddenly in past 16 months. Doctor writes to Canadian Medical Assocation to investigate.
Canadian woman drops dead after getting the booster at Saskatoon Shoppers Drug Mart. While someone witnessed it,coroner states it’s due to “natural” causes.
News Anchor from KJRH-TV, which required all employees to be fully “vaxxed”, suffers stroke on air, spends 2 days in the hospital, and will be off air for several weeks.
Hollywood makeup artist dead 9 days after getting monkeypox vaccine.
20 year old Canadian junior hockey player collapsed and died during preseason game.
Brown University student forced to get the vax hospitalized with what appears to be myocarditis.
37 year old mountain biker died in his sleep just two days after winning Scottish championship.
Mother forced to get jab due to needing a possible C-section in hospital now has a hospitalized baby needing a brain scan, and who is constantly shaking and in pain.
Formerly healthy mother has 3 visits to the ER and neurological exam for 2 days in hospital – now has uncontrollable shaking with no diagnosis or follow-up from CDC/FDA or VAERS.
Mother has red, raw, swollen body & rashes after shot. The steroids she was given make her suicidal, aggressive, and out of character. On suicide watch.
Mother of four develops shortness of breath, heart palpitations, and 3 abnormal EKGs, but doctor blames anxiety. Finally diagnosed with pericarditus, a known side-effect.
Once healthy mother spasms uncontrollably after J&J shot. Also has headaches, neck pain, nausea, tremors, difficulty swallowing, speaking, and can only walk with assistance.
Japanese womanloses all her hair (alopecia) within days of COVID shot.
Philippino flight attendant suffers severe asthma which led to cardiac arrest and brain hypoxia.
6 year old Mexican boy faces multiple amputations (hands, feet, and ears).
Ukranian woman suffers with swollen legs and fluid everywhere. Must take unpleasant cholesterol lowering drugs and inject her stomach to prevent blood clots. Biopsy shows membranous nephropathy.
Woman gets pericarditis after shot and can no longer take care of daughter or work.
Woman suffers from dysautonomia(tremors, fainting, tics, brain fog, memory loss) as well as nausea, fatigue, pain in wrist and hand that got the shot, heart & blood pressure issues, & speech problems.
Two friendsdie three weeks apart. One of a ruptured brain aneurysm and th eother from a “medical emergency.” Both were CA healthcare workers mandated to get the shots.
42 year old triple-vaxxed Irish law professor dead.
43 year old man found at home in advanced state of decomposition due to thrombosis that caused an ischemic stroke & internal bleeding following Pfizer jab
Previously healthy man gets arm amputated, congestive heart failure, a blood clot in the heart, double pnuemonia, and he may need his legs amputated also due to blood clots.
Healthy 12 year olddead from heart attack after the injection.
Woman suffers from abnormal T2 signal, abnormal head-up tilt table test, develops autonomic dysfunction, Meniere’s disease, vertigo, cervical dysfunction, 12 days after Pfizer shot.
Young girl’s kidneys shut down, has internal bleeding, dead.
Young woman who had her eczema under control breaks out worse and worse with painful eczema with each COVID shot
38 year old woman’s hair falls out, is hospitalized and intubated 5 times, suffers uncontrollable movement, & muscle spasms, now diagnosed with progressive neurological disease
36 year old TikTok star dead after hearing voices in her head.
Texas mom found dead in car weeks after being reported as missing. #ABV
Woman develops seizures, uncontrollable spasms, irregular heart rate, rashes, and requires a walker.
Woman gets shot to see grandparents, but now hates herself for it due to side-effects. Couldn’t see grandparents anyway due to health guidelines.
Woman gets body-wide rash and sores two days after second dose.
Young man gets arrhythmia, chest pains, rapid heartbeat, high blood pressure, fatigue, blisters, fainting and dizziness, lack of feeling in hands.
Woman forced to get jab for her job convulsed for two full days. Swollen tongue, blurry vision, metalic taste, 3-7 convulsions daily, involuntary body movements, high heart rate, can’t focus.
Teacher coerced to get jab to keep job got body-wide rashes & is hospitalized.
Woman has chest pains, random dizziness, cold chills, pins and needles through body, heart palpitations, fatigue, inflammation, nerve damage and shaking after shot but was told it’s anxiety.
Two Ontario brothers who got the boosters together, die suddenly and unexpectedly of heart attacks
North Carolina woman (fully vaxxed) suffers post-shot blood clots, amputations, surgeries, ventilators but blames COVID.
Canadian woman gets post-injection autoimmune issues (relapse-remitting MS) & a rash but repeats the lie that it would have been worse if she wasn’t “vaxxed”
25 year old Norwegian beauty entrepreneur suffers menstrual bleeding everyday for a year since her 2nd Pfizer shot.
39 year old narrowly escapes amputation after Turkish doctors pull several 4 inch long blood clots out of his leg. Got the J&J shot to travel.
Woman gets seizures & shaking after shot. Can no longer work or drive.
48 year old caregiver coerced into shot suffered metalic taste in mouth and swollen tongue. Now has two day long seizures. Can’t work.
Formerly fit man who climbed mountains now can’t ride his bike for 10 min after shot.
Air Force Major suffers heart inflammation, tinnitus, brain fog, myalgia, bruising, and other symptoms after coerced COVID shot.
At least 58 infants had life-threatening side efects after shots.
2 month old suffers cardiac arrest one hour after shot.
27 babies suffer “neuroleptic malignant syndrome” a life-threatening reaction like those who react to antipsychotic drugs which causes high fever, muscle stiffness, altered mental status, excessive sweating & saliva, wide swings in blood pressure, and dysautonomia after COVID shot.
“Vaxxed” Guitarist found unconscious, taken to hospital where he was intubated & in a coma for 3 weeks. Blood clots shut down his kidneys & other organs leading to 8 fingers being amputated
12 more “sudden and unexpected” deaths (including a Stevens Point, Wisconsin 15 year old)
36 year old YouTuber gets post-injection ovarian cancer diagnosis
32 year old Pennsylvania woman develops POTS, chronic nerve, muscle, joint & jaw pain with neck stiffness
59 year old New Yorker goes to ER due to leg numbness, and now has peripheral neuropathy with tingling and rashes and bruising
43 year old Spaniard develops headache, dizziness, pain in eyes, earaches, sensitiveity to light, extreme fatigue, insomnia, head zapping, pain and numbness in legs, chest palpitations, breathlessness, pins & needles sensation, and anxiety
Santa Fe woman develops hair loss, heart palpitations, involuntary muscle movement, pain, & insomnia
48 year old Floridian gets arm pain, swelling around eyes, debilitating headache, dizziness, & fatigue, brain fog, short-term memory issues, neck pain, pins & needles sensations
37 year old Canadian woman has anaphylactic reaction within 10 min of shot, full blown hives, cough, tongue, face, and neck swelling. Now suffers daily anaphylactic mast-cell attacks that require epinephrine
Young woman diagnosed with Lupus after shot. (Bruises all over body, joint and chest pain, sun and light sensitivity, extreme fatigue, hair loss, and various rashes)
Irish woman experiences bruising, loss of vision, pain, and facial paralysis after jab. Doctors gave her a diagnosis that is incurable & refractory. She has filed a criminal complaint & now runs a support gruop for those similarly affected.
Teenager required to get jab to stay on sports team suffers neurological damage, faints, shakes uncontrollably, visits ER. Uncertain future.
16 year old experiences stabbing pain under rib cage & nausea, but doctors take out a perfectly health appendex. Develops severe tics – lasting 4 hours, passes out from exhaustion. Light and noise sensativities, memory loss, legs collapse.
Woman experiences “normal” side effects until she developed severe neck pain, and tingling and numbness on her left side & limited mobility after Pfizer jab.
38 year old Ontario woman develops blood clots, convulsions, fatigue, burning veins, pain, and neurological issues after Pfizer jab.
Indiana woman develops Guillian-Barre & paralyzed after COVID jab. In rehab now.
Brazilian girl suffers stroke after shot and is relearning how to walk after COVID shot.
German news report on woman requiring emergency operation due to thrombosis in the brain.
Young man from Germany hospitalized with heart muscle inflammation after shot.
German woman with heart muscle inflammation after shot.
41 year old Arkansas woman gets swollen lips, tightness in throat, rashes, body pain and an autoimmune disease after two shots of Pfizer.
Formerly healthy man forced to get jab to keep job, hospitalized for pneumonia & still suffering a year later from nausea, chronic fatigue, and headaches. Diagnosed with gastroparesis & pitutary disorder.
Woman vaxxed at grocery store hospitalized with heart attack and blood clots in lungs.
Canadian care worker forced to get jab to keep job suffers muscle cramps, convulsions, temporary blindness, heart palpitations, shortness of breath, & depression after shot.
26 year old man suffers uncontrollable convulsions after Moderna shot.
ESPN analyst not able to cover NFL draft due to blood clot.
47 year old Canadian woman goes to ER twice and struggles with severe pain.
Autopsy reveals deathdue to COVID shots/booster. Daughter develops itchy rash for 3 weeks that her doctor states was due to ‘vaccine’ shedding from her father.
Woman gets severe swelling around eyes, & multiple rashes after jab.
8 year old gets enlarged heart, continual seizures, after Pfizer shot and sent to psych ward after being accused of doing drugs.
Ontario student dismissed by doctors after getting chest pains after Pfizer jab. Due to not getting 2nd dose, she is not allowed to enter the University campus.
38 year old “vaxxed” editor at USA Today has heart attack & is found dead on his couch.
3 more athletes collapse and die (heart attacks, brain bleeds, cardiorespiratory arrest, etc.)
59 year old banking regulator dead after Pfizer jabs.
33 year old, previously physically active, healthy woman now has involuntary muscle contractions, weakness, shaking, and can barely walk after shot.
24 yeardead of sudden ruptured brain aneurysm –also had injection site, muscle, & back pain.
Womancan’t feel lower part of her face including her teeth after shot. Doctors brush her off.
World champion inline skaterfeels faint,numbness in teeth & cheeks, headaches, tingling arms, eye-balls hurt & blurred vision, & shortness of breath. Couldn’t walk or talk & had a stroke.
South African media personality, Kuli Roberts, dead after Pfizer jab.
Woman develops painful body-wide rash. Can’t do normal functions & hardly gets out of bed.
Thousands of women reporting mentrual side-effects(missed periods, more bleeding, pain)
26 year olddead of myocarditis. Autopsy found COVID shot a contributing factor.He had successfully recovered from reversing a brain aneurysm and had “a healthy, strong heart,” based on echocardiograms conducted before his surgeries.
22 year old forced to get jab to keep job, gets blood clot which caused severe pain in arm.
Woman disabled after COVID shot. Suffered from black outs. Hospitalized for 4 days.
8 year old develops post-injection neurological disorder & struggles to walk and talk.
5 year old Filipino girl hospitalized and on life support less than 13 hours after shot.
54 year old triple-vaxxed Australian TV personality blames “long COVID” for her pericarditis and deteriorating health.
7 more “vaxxed” young people die suddenly and unexpectedly.
US military personnel continue to suddenly and unexpectedly die as mainstream media blame suicides. Fort Bragg has stopped releasing details of deaths.
42 year old quadruple-vaxxed Canadian ER doc sick with COVID & admits all docs in his department who got COVID were triple-vaxxed. Abruptly disappears from Twitter.
44 year old diagnosed with aggressive post-injection brain cancer. Dead 3 weeks later.
Within minutes of shot, woman can hardly walk, suffers with weakness, tremors, headaches, and pain.
Frontline worker in Singapore lost feeling in her legs. Still struggling neurologically a year later. Doctors blame her DNA.
Previously healthy man forced to get jab to keep job now has myocarditis. Has chest pain, shortness of breath, brain fog, high troponin level. Cardiologist got him a vaccine exemption but due to his company’s ‘vaccine’ mandate he was stood down without pay. Must keep heart rate low. He also tested positive for COVID even after shot.
Pilot forced to get jab to keep job, passes out and suffers a heart attackminutes after landing the plane. Will probably never be able to fly again.
Previously healthy woman develops heart inflammation, numbness, seizures, and high blood pressure after Moderna shot.
23 year old drops dead at work after 2nd shot. Coroner finds an enlarged heart.
Woman gets racing heart rate, trouble breathing, & dizziness after shot. Symptoms worsened requiring a trip to the hospital.
Woman gets shot to travel but now has a painful lump on arm. Can’t sleep on her side now.
Young woman has severe head pain after shot. ER gave her no treatment & said she was fine.
57 year old Scottish man has leg amputated due to blood clots after shot. This is not rare.
Hour long video of COVID shot effects. People dropping and spasming uncontrollably.
8 minute video by The American Journal showing people with adverse neurological, pulmonary side effects, such as spasms, seizures and lung clots.
4 cases of erythema multiforme (EM) within 10 days of Pfizer shots (rashes and lesions in mouth, face, and body)
Previously healthy Danny Hubbard needs round the clock care. Can’t open left eye or speak, has 24/7 muscle jerks, tremors, and seizures after jab.
Woman who used to debunk vax reactions ends up in hospital with severe heart issues
27 year old Italian pro swimmer dies suddenly and unexpectedly of a heart attack.
56 year old fully vaxxed NY cop dies after getting jaundice, liver problems including blockage and scar tissue requiring a biopsy.
Fully vaxxed and boosted comedian dead from heart issues.
Doctor profusely vomits after COVID shot, was put on the ventilator four times due to an inability to breathe, had nausea, dizziness, heart palpitations, put on blood thinners, had abdominal distention, GI bleed, & collapsing vocal cords.
Champion shooter admitted to hospital for Guillian-Barre syndrome 10 days after shot. She was paralyzed from head to toe, & couldn’t swallow.
Fully vaxxed and boosted man now has hives and extreme skin sensitivity.
Fuly vaxxed woman taken to ER for symptoms of heart attack and blood clots.
22 year old Utah woman with 6 pre-existing conditions required to get jab for heart transplant suffers skin reaction, (painful blistering) needs oxygen to breathe.
Fully vaxxed 54 year old free-lance journalist dead. His hatred of the unvaxxed is palpable.
Son describes the Creutzfeldt-Jakob Disease (CJD like mad cow disease) that took his mom’s life after her second shot. (Fixed eyes, howling, non-stop violent tremors, couldn’t walk or feed self)
Canadian woman still suffers severe debilitating neurological symptoms a year after shot.
Man gets fever, chest pains, shortness of breath & is diagnosed with pericarditis.
16-year-old Australian now crippled with convulsions, persistent nausea and visible tics. Health officials admit “there is no question Faith has had a delayed reaction to the second Pfizer vaccination”.
34 year old UK mother dead from catastrophic brain bleed 9 days after shot. Doctors ruled it was “vaccine” induced thrombotic thrombocytopenia (VITT)
31 year old UK father dead from “vaccine”-induced brain hemorrhage
Formerly healthy mom gets uncontrollable tremors, can’t hold a pen, drive, or walk, after jab.
Caretaker who got jab to save job now has body-wide tremors and is unable to do her job.
52 Australian cricket icon tells world to “get vaccinated & learn to live with it,” suffers heart attack and dies.
Young man paralyzed from the waist down 12 days after J&J shot. Neurologist concerned it’s a myelinic form of post-vaccinal acute disseminated encephalomyelitis (ADEM).
Director of Mayo Clinic’s Vaccine Research Group develops life-altering tinnitus. He states millions globally could also be suffering the same fate.
52 year old woman dead from “vaccine” induced thrombocytopenia (blood clots) from J&J shot. ‘Powers that be’ still state it’s “rare.” Scroll through and determine for yourself just how rare blood clots are, with what I now label “clot-shots.”
Pilot gets brain swelling, tunnel vision, & 6 spinal taps after jab. Can never fly again.
Nurse and mother couldn’t lift her arm for 3 days, developed fatigue, severe pain in her elbows, knees, and ankles, got shingles and sharp pains in her chest, legs, and back, blurred vision, numbness, burning sensations, involuntary muscle jerking, tingling, lost neck function, memory loss, throat tightness, and internal vibrations.
2nd year pre-med student suffers nausea & vomiting hours after Pfizer jab. Next came back pain, severe rash, blood in his urine, and a 3 month hospital stay. He developed cataracts and tinnitus that progressed to deafness and kidney failure.
Woman with epilepsy, which was in remission, and other autoimmune disorders, gets epilepsy back after COVID shot.
52 year old woman dead after J&J shot. (Blood clotting disorder)
Woman loses ability to talk or walk normally, clean, cook, or hold her baby, yet doctors gaslight her and deny the link to the injections.
Man suffers near blindness & detached retina when a vein burst in his eye. He was denied an exemption from further COVID shots.
Within 10 minutes of jab, woman can barely move legs and needs a walker. Nonstop headaches, nausea, and other serious problems.
Highschooler suffers fevers, vomiting, headache, stroke (brain bleed & blood clots), coma, after J&J shot. Now wheelchair bound.
Woman goes to the ER 30 times (code stroke symptoms) after Pfizer jab. Suffering severe neurological issues.
Woman suffers severe allergy after 2nd Pfizer jab. Hives, fatigue, hair loss, no energy, and is very sick.
Minnesota Representative dead after fighting a battle with kidney cancer, was “vaccinated” and also got COVID.
39 year old Brazilian woman gets blood clots, has leg amputated 15 days after shot.
34 year old Canadian man collapses & dies in front of his children.
36 year old CA Sheriff’s deputy dies unexpectedly after heart attack.
Canadian man spends 10 days in hospital to treat post mRNA shot heart attack.
Woman felt “weird” & delirious after COVID shot blacked out and began seizing, was intubated, and struggled with fear and anxiety.
Woman states her body was magnetized after 2nd COVID shot. She developed GBS, postural orthostatic tachycardia syndrome and pericarditis. She states VAERS is a bust with only 50 employees involved.
Two Young mothers lose babies after COVID shots. One baby developed severe blood clot and brain bleeding.
Comedienne Chelsea Handler’s comedy tour “Vaccinated and Horny” is cancelled due to a “health scare.” She admits the first shot made her deaf in one earand that she “feels sick.”
49 year old Australian radio and TV personality gets shingles, a common and well documented adverse reaction two months after booster.
Former pro football player dead 5 days after booster shot.
Ballgirl at Australian Open collapses on court during match.
Woman develops 3 lumps on her head following first COVID shot. Doctor tells her not to take any more shots, as they will soon be halted globally due to new info not avail. to the public.
Female Olympic athlete diagnosed with pericarditis after booster shot.
Punk icon put in induced coma 1 month after COVID booster. Has bleeding in the brain.
6 year old boy from Portugal dead from cardiac arrest after first Pfizer shot.
10 year old Brazilian girl suffers cardiac arrest 12 hours after first Pfizer shot.
6 year old MN boy develops myocarditis, can’t eat on his own or swallow saliva.
Comedian collapses on stage immediately after bragging, “I’m vaxxed, doubled vaxxed, boosted….” Spokesperson blames dehydration, resulting in a skull fracture. She appears on Ask Dr. Drew who told her his friend was destroyed by the booster and can’t walk.
8 days after man was forced to get jab to keep job, he had a basil ganglia hemorrhagic stroke which left him unable to walk or use his left arm.Employer refuses to cover medical costs.
Dr. Neil Singh Dhalla dead 4 days after getting COVID booster. Autopsy said myocarditis.
Toronto father tells board members his 17 year old son, forced to get vaxxed to play hockey, developed a rash, went to the hospital – sent home with Advil. Mom found him dead on the floor.
Healthy Louisiana man develops autoimmune disease, then dies after 2nd COVID shot. Doctors agree that the COVID “vaccine” caused an immune response that led to the development of the autoimmune disease.
Ontario woman develops POTS and dysautonomia, and is unemployed after Moderna shot.
53 year old triple vaxxed Manitoba teacher dead after “sudden intense illness.” Media blame COVID.
Australian epidemiologist and WHO adviser who called unvaxxed “self-centered” got severe headaches. Diagnosed with a cancerous brain tumor.
70 year old that stated, “get the vaccine, not dewormer,”dead 10 weeks after Moderna booster.
COVID jab victims talk about the health horrors they’ve suffered since they took COVID shots — the safety of which is actually still unknown. “Don’t get this poison,” ~ jab victim
Wheelchair bound Australian woman gets heart palpitations, aches, fever, chest pains, breathing difficulty. Diagnosed with pericarditis.
Prince Edward Island woman gets Pfizer shot and within minutes has a metallic taste in her mouth, gets dizzy (fell & broke her nose), nauseous, couldn’t swallow, arm numbness & pain, headaches, brain fog & spaciness, was able to get an exemption.
46 year old Canadian woman gets severeBell’s Palsy, tonsil stones, and had to get a feeding tube for 18 days in hospital & it’s only getting worse. She states, “I hear there is over 200 of us.”
Mother warns others about breastfeeding after COVID shots. Son got body wide rash.
Girl shakes uncontrollably & can’t hold up her head. Doctor said,“there is no point in doing any more tests.”
17 year old athlete hospitalized for 9 days with clot in jugular vein and 2 brain blood clots
43 year old CBC radio host dead after post-Moderna “serious illness”
Spanish basketball player collapses & convulses on court
49 year old Wall Street Journal & NY Times Writer dead hours after jab.
40 year old French man gets chest pain & shortness of breath after jab. Diagnosed with post-injection pericarditis.
22 year old college student suffers 94-straight days of vaginal bleeding after Moderna shot.
24 year old missionary & numerous othersdead after church policy mandates jabs for those traveling outside their own country. (See link for LDS church stock holdings in J&J, Apple, Microsoft, Google, Amazon, Facebook, and more. It owns $81 million in Pfizer.)
Covidblog receiving 2-3 emails per day reporting deaths and maimings since “vaccine” mandate went into effect in the Philippines. Their President not only mandated that all non-vaxxed people stay-at-home indefinitely, but also ordered police to arrest any non-vaxxed person who violates the order.
American actor & comedian Bob Saget dead one month after COVID booster shot.
14 year old Israeli American girl dead from heart attack after COVID shot.
28 year old Brazilian singer dead 6 weeks after jab. (pulmonary embolism)
Brazilian TV personality suffers cardiac arrest during live broadcast 1 week after COVID jab.
25 year old Guatemalan football player dead after heart attack.
Triple ‘vaxxed’ healthy Swiss marathon record holder & Olympic athlete gets myocarditis after booster shot. Now unable to compete.
Fully ‘vaxxed’ tennis star forced to quit game after chest pain & breathing difficulties.
Double ‘vaxxed’ healthy 23-year-old healthy scientist, & power lifter champion, died after testing positive for Covid-19.
NY Times editor dead of heart attack one day after booster shot.
Social Media Influencer gets Bell’s Palsy after COVID jab.
Previously healthy Canadian girl in wheelchair after Pfizer (Electric shocks & numbness in legs)
Dancer Maxwell Harris diagnosed with pericarditis after jabs. No exercise for a year, & uncertain future.
Woman forced to get COVID jab for her job now without job – needs a walker and help to do basic personal tasks, but is not permitted an exemption for the 2nd shot nor compensation. Ignored by MSM.
Formerly healthy 19 year old Australian vomiting, fever, shaking, sore joints, blurred vision, headache, pain all over after 2nd Pfizer jab. D-dimer test positive, rushed to the ER – has blood clots body-wide including her lungs, chest, and lungs. Back in ER with chest pain.
News video shows death & adverse effects from around the world.
80 year old gets bruises, black blisters, and shakes, spending 17 days in the hospital with brain bleeding & a platelet count of zero. Now needs 20 pills a day to survive.
Healthy 33 year old New Zealand nurse gets pericarditis after 2nd shot & is seventh person admitted that day with heart problems after shot.
Australian tennis player Pat Cash states doctors convinced his 89-year-old mother to get the COVID-19 injection which resulted in days of headaches, two strokes, and a heart attack. Nothing was reported.
120 teens hospitalized,3 dead following Pfizer “vaccine” rollout in Vietnam.
15 year old German girl dead after massive heart attack 10 days after 2nd Pfizer shot.
Australian dad gets shot to keep job – diagnosed with pericarditis. Second shot forthcoming.
33 year old occupational therapist has heart problems & was “afraid I’m going to die.” Gets zero help from doctors.
44 year old Australian truck driver suffers uncontrollable convulsions & seizures after COVID shot.
39 year old Canadian woman gets injected to travel, dead 4 days later.
Former Pro-basketball player diagnosed with pericarditis after 2nd Pfizer shot.
Formerly healthy 23 year regrets getting COVID shot. Now having seizures and is unable to walk.
List of 75 athletes who collapsed or died during sporting events from June to October 2021.
35 year old Florida man gets jabbed for job, suffers massive heart attack, dead 12 days later.
35 year old Hawaii woman diagnosed with pericarditis after Pfizer jab.
54 year old Canadian woman hospitalized with severe damage to vital organs including a swollen liver & phrenic nerve paralysis(right lung collapsed) requiring an oxygen tank.
Wisconsin news anchor posts photos of whole family getting jabbed. Husband hospitalized days later – she blames COVID.
Horribly deformed baby born to mother who got COVID shot. I believe the baby died based upon the usage of past tense in the FB post.
FL firefighters receiving excessive amount of 911 calls from COVID “Vaccine” reactions. Transporting more “vaccinated” with adverse reactions or COVID than unvaccinated. Hospital in denial.
Former 2017 Davis Cup winner (tennis) announced he will no longer compete this year due to the crippling effects of the COVID shot. (violent near-paralyzing pains across his body)
19 year old Ukrainian student gets COVID jab behind his parents’ back, dead 7 hours later.
64 year old physician “horribly ill” and “incapacitated” after getting shot (severe paresthesias, chest tightness, tremor, dizziness, headaches)
16 year old Brazilian girl develops blood clots, dead 8 days after jab.
49 year old Italian woman dead 12 hours after jab.
67 year old that said,“damn the unvaccinated,”dead 12 days after jabs.
25 year old football player mandated to get the jab collapsed after game, dead shortly after.
Woman diagnosed with acute disseminated encephalomyelitis (ADEM) after COVID jab. MRI showed widespread demyelinating lesions.
64 year old woman develops Creutzfeld-Jakob Disease(human form of Mad Cow disease) after jab, dead 3 months after second dose.
Despite taking every precaution, fully “vaccinated” Southwest Airlines flight attendant dies of COVID.
16 year old Tennessean collapses at school, dies days later after jab.
38 year old Italian volleyball player develops pericarditis after second jab.
31 Ohio woman talked into getting jab by doctor develops blood clots, myocarditis 3 days later
44 year old BBC Radio Host dead from COVID jab complications (thrombotic thrombocytopenia)
Chinese man dead after Pfizer shots. (couldn’t walk 2 weeks after jab, then diagnosed with boblet cell adenocarcinoma, a tumor forming cancer before succumbing)
41 year old wheelchair bound after jab. (They are threatening her doctor who firmly blames the shots & is treating her with HCQ and Ivermectin, which she states are helping a bit.)
LA pediatric dentist has still born baby 12 weeks after jab.
39 year old French man dead 40 hours after 2nd shot.
63 year old CEO taunts unvaccinated before dying 18 months after jab.
Fully COVID “Vaccinated” man dies of COVID. (Mostly stayed indoors and wore a mask) But with religious fervor the doctor believes he would have suffered more if he hadn’t been vaccinated. Last time I checked, it doesn’t get much worse than death.
40 year old Ohio woman loses friends, gains enemies for chronicling her spiraling health after 2nd shot.
Actress Sally Kirkland, healthy before the injections, remains in constant pain 5 months after getting the jabs. She states, “Like I know my own name, I would advise you not to do the vaccine.”
San Antonio couple both dead after COVID vax. Daughter states she believes the shot reduced their sufferingbefore they died after getting it. Texas claims43 breakthrough deaths.(deaths from COVID in fully “vaccinated” people)
14 year old boy diagnosed with heart inflammation & “post vaccine myocarditis” after getting COVID jab. Mother states CDC doesn’t explain that “mild myocarditis” means hospital care and indefinite follow-up care.
Former Marine health care worker required to get COVID jab for employment, dead after 2nd dose.
23 year old woman dead from blood clot after COVID jab.
25 year old Ohio man develops myocarditis & is hospitalized. Doctors initially refused to connect the dots. Finally a doctor stated, “Everybody has allergic reactions and your son just had an allergic reaction to the vaccine.“ Nobody reported it to VAERS even though health care providers are legally required to.
Woman develops tiny blood spots all over her body, muscle aches & fatigue after 2nd shot. She needed 2 platelet transfusions, and IVIG. Diagnosed with immune thrombocytopenia (ITP), the authors decided ITP is a severe adverse effect of the Pfizer shot.
22 year old French man dead 9 hours after first shot.
64 year old retired journalist dead 12 weeks after second shot.
49 year old Italian woman in intensive care for 3 weeks, dead four weeks after first shot.
65 year old “Braveheart” actor dead six days after booster shot.
Comedian states severe symptomsnever went away after COVID shots. (fevers, body aches, joint pain, exhaustion and a stiff neck) He was also told by a doctor he has brain inflammationlikely caused by the spike protein in the Moderna vaccine.
80 fully “vaccinated‘ Mass. residents have died from COVID-19 as breakthrough cases surpass 5,000.
27 fully “vaccinated” people have diedfrom COVID in Tennessee, health department says.
Fully “vaccinated” New Orleans woman diesof COVID.
39 year old Canadian man gets dystonia & seizures after shot. (Trouble walking & breathing) Ivermectin is keeping him functional.
18 year old Italian volleyball player dead 27 days after first shot.
3 teenagers suddenly collapse and die after shots.
49 fully “vaccinated” people in N.J. have died of COVID.
Man suffers two contralateral Bell’s palsy episodes after each injection.
Preschool teacher from Utah was has developed life-altering injuries after participating in AstraZeneca’s “vaccine” clinical trial. She has accumulated more than $250,000 in medical bills
Texas realtor diagnosed with GBS after J&J injection. Has to walk with a walker now.
64 year old Canadian man suffers sudden aortic dissection, dead 30 days after shot.
Two Jamaican cricket players collapse on field 3 days after shot.
18 year old Italian girl dead after shots. Neurosurgeon performing her autopsy states , “I had never seen a brain reduced in those conditions by a thrombosis so extensive and so serious.”
63 year old Oregon woman afraid she’ll die any day after the J & J shot. (She’s coughing up chunks of blood, had a fever, cramps in her legs, and is severely fatigued. An ER visit revealed blood clots in her brain, lungs, stomach, and throat.)
California mother has seizure and cardiac arrest and a week in ICU after COVID shot. She died.
Another California mother is in a coma and has been unresponsive since May 21 after 2nd COVID shot.
61 year old Maryland woman dead within 24 hours after shot.
39 year old woman dead 12 hours after shot. The shot was a “prerequisite” to donating an organ to her husband.
35 year old woman developed blood clot issues requiring brain surgery after COVID shot. She died from a bleed in the brain while recovering from surgery.
32 year old man has major stroke and then died after shot.
54 year old Australian filmmaker dead 2 months after jab.
44 year old BBC presenter dies of blood clots after injection.
NJ bishop hospitalized for blood clots after COVID jab.
Another woman stuck with medical bills (over $1 million) after blood clots caused most of her organs to shut down, the need to remove most of her small intestine necessitating a permanent feeding tube, and physical therapy to relearn how to walk and use a fork.
32 year old single mom intubated after Pfizer shot. Now in physical therapy to learn to walk & talk again.She owes $160K in medical bills.
Musician Eric Clapton regrets getting COVID jabs that caused his hands and feet to be “useless” for 2 weeks causing him to fear he would never play music again.
75 year old Madison, WI woman dead after injections.
Former head of Indian Medical Association dies from COVID after being fully “vaccinated.”
British model in Cypress dies after shot (blood clot). Cyprus health authorities now investigating see if the “serious thrombotic episode” was linked to the AstraZeneca jab.
43 year old Canadian man has 7 feet of intestines removed after vaccine-induced blood clots. He states he wasn’t adequately warned of vaccine risks. A University of Toronto professor, epidemiologist, and infectious disease specialist believes that Canada may have initially missed signals that COVID injections given to older people caused strokes.
Syracuse teachers union president dead 10 weeks after second shot. (This and a few other “near-term” deaths have occurred. Dr. Tenpenny states the real damage begins from day 42 on after the injections are given, specifically with ADE.)
Health care workers no longer able to work speak out about tremors, memory loss, and “full-body convulsions” after shots.
Ohio doctor dead after mockinglywriting his own obituary.
The Israeli People`s Committee, an independent organization relying on publicly available information, states that risk of death is greater after the second injection with a high rate of cardiac related injuries. They also ask that the radical idea of vaccinating children be completely rejected. “Never has a vaccine injured so many! “
“Doctors for COVID Ethics” recently gave evidence regarding risks. The science shows these injections are dangerous, unnecessary, and lack efficacy.
World renown vaccine specialist, Geert Vanden Bossche, states mass vaccination drives viral immune escape, and countries undertaking mass vaccination, (UK, Israel, USA), will initially experience a drop in infectivity rates, but they willinevitably suffer a steep incline in severe COVID cases in the weeks to come.
Increasing “vaxxidents” are occurring. In once such case, a driver who had just received his second COVID-19 injection, “went blank and started holding his chest.” (Thankfully his wife steered the car to safety.)
Women getting shots, and women NOT getting the shotsbut are around those who have, are reportingsevere cramping, heavy bleeding for days on end, post-menopausal women suddenly menstruating, and irregular periods.(Women are up to 4 times more likely to experience adverse reactions to these injections than men.) More reports also coming in on miscarriages, hemorrhaging, passing clots, delayed cycles, and abnormal pain, and milk supply stops after nursing mothers get injection.
UK miscarriages, in just 6 weeks, skyrocket366% after shot.
Concerns of the “vaccinated” causing harm to the unvaccinated.Video explanation (Approx. 12 Min).
We’ve been warned about self-replicating “vaccines” that spread like a disease. The link also explains “virally spread immunocontraception.” i.e. sterility. Ten institutions, primarily in the U.S. but also Europe and Australia are currently doing significant work in the area. This research has been bankrolled by the National Science Foundation, the National Institutes of Health, and the Department of Health and Human Services. Private organizations like the Gates Foundation and academic institutions have also financed projects. Recently, the Defense Advanced Research Projects Agency (DARPA) has gotten involved in the research. The concern is dual-use – that the same research that is used to develop self-spreading vaccines to prevent disease, could also be used to deliberately cause harm, and which could be uncontrollable and irreversible.
America’s Frontline Doctors state the spike proteins in these injections are pathogenic(“disease causing”) just like the full virus, and that a person’s body is being suddenly flooded with 13 trillion of particles which bind more tightly than the fully intact virus. Because of the biomimicry (similarity) on the spike protein, shedding appears to be causing wide variety of autoimmune disease(where the body attacks its own tissue) in some persons.
5 doctors state the injections are bioweapons. (This was never a viral illness but blood poisoning due to a spike protein. The injections are NOT “vaccines” but cause YOU to manufacture spike proteins – perhaps indefinitely – the very thing causing illness. Those getting the shots are now transmitting this spike protein to those who are foregoing the shots. Those getting the shots should be quarantined.
Coroner’s office investigating death of CA woman who died several days after 2nd injection.
Despite being fully “vaccinated”, 58 year old Israeli fashion icon dead. (European new sources are blaming the “South African variant of COVID-19″).
54 year old Canadian woman, 48 year old Australian woman, 27 year old British engineer, 35 year old Ionia Co. woman, ALL DEAD after injections. Nearly all developed blood clots.
Judith Reisman, adversary of the porn industry dies 10 days after shot.
A 30 year old Bay Area man’s case is the first instance of U.S. public health officials acknowledging “vaccine-induced thrombotic thrombocytopenia syndrome”. (After J&J injection)
VAERS data show reports of blood clotting disorders after all three EUA “vaccines.”
Leaked study states Pfizer injection may cause heart inflammation in those under age 30.
Dozens in Central Florida contract COVID after getting shots.
246 fully “vaccinated” Michigan residents get COVID, 3 dead.
British Columbian doctor defies gag order and states shots killed and permanently disabled Indigenous people in his community. (The doctor states this method of intimidation is being used against other doctors who have become too afraid to speak out, because the College of Physicians and Surgeons has great authority to shut down doctors’ careers, or heavily fine them – just like with those who dare to treat Lyme/MSIDS.)
Indian actor turned “health ambassador” dies 2 days after shot. (Last month, an analysis of 79 Indians who died after a dose of a COVID-19 vaccine found that around half suffered strokes or heart attacks.)
In California, recalled dictator Gavin Newsom, is partnering with two hundred “faith based” organizations to set up “pop up” vaccine clinics. What were once reverent churches, are now being converted to government and vaccine worship centers.
Pro-“vaccine” cybersecurity expert dead after shot.
Study states Pfizer’s COVID injection may trigger Herpes virus that causes Shingles. Two centers in Israel have recorded six such cases.
20-year old Scottish man dead 12 hours after shot. (Whole body pain, high temperature, suffered a seizure where foam was coming out of his mouth)
Two Australian seniors die after shot. Both were reportedly in good health prior to the injections, but both developed pneumonia after the shots and died soon after.
Serious illness in Denmark, including death after jab. (Blood clots and cerebral hemorrhage)
Nine Irish nursing home residents die of COVID despite being mRNA “vaccinated. The Irish Health Products Regulatory Authority said it has received reports of 17 elderly people dying after receiving experimental shots as of early march.
Australian sailors are suffering widespread adverse reactions, but only sanitized media news reports of “mild side effects” are to be found despite the fact the ship’s crew needed hospitalization. Tellingly, the government is quietly “walking away” from mass vaccination plans.
Pregnant Pediatric nurse delivers stillborn baby eight days after second injection. (Details in link)
Boxing Champ, Marvin Hagler dead. Pharma-controlled media silent on the jab.
Twenty nations halt COVID shot after reports of blood clots. (But we are told benefits outweigh risks) Chief physician and professor Pål Andre Holme has come forward stating the injection triggered a powerful immune response caused by specific antibodies against blood platelets.
UK changes stance on pregnant women getting the injection – causing at least 20 miscarriages so far.
South Korea reports 7 deaths and 2,800 adverse reactions.
Austria’s Federal Office for Safety in Health Care (BASG) is suspending administration of Oxford/AstraZeneca viral vector “vaccines” after one death and another severe adverse effect.
46 Spanish nursing home residents in Andalusia, 22 in Chiclani, and another nine in Lagarteradie from the shot and all experience a COVID outbreak after the injection. Health officials have halted the second shot due to the deaths.
32 dead and 137 infected in NY nursing home after shot. “The outbreak started at the same time the facility started to administer the COVID-19 vaccine.”6
23 from Norway dieafter shot. The agency noted that the vaccine may indeed have caused side effects that led to “a more serious course of existing diseases in older people.”
22 elderly die in the Netherlands within a week of the injection and many become infected.
22UK nursing home residents died after shot. (COVID is blamed but deaths occurred after the injection. Many are testing positive after the injection.)
12 diein Wale’s nursing home, while 36 residents and 54 staff are now testing positive for COVID.
8 German nursing home residentsdieafter being forcibly injected.“We’re dealing with homicide, maybe even murder.” – Attorney Reiner Fuellmich Source According to the Defender, 25% died immediately after the injection and 36% were severely injured within a short time.
Polish doctor mocks “anti-vaxxers”, dies days after the shot.
Wisconsin healthcare worker dies days after injection.
Dr. Sara Beltran Ponce of Milwaukee, WI miscarries 3 days after injection.
So many French health workers suffered from side-effects that the French vaccination task force recommended staggering the vaccination schedule for people working in the same care unit.
Dozens of Italian teachers too ill to teach after the jab.
Memphis doctor dead(The CDC is calling it a rare COVID-related syndrome but he died weeks after the injection and he already had natural COVID antibodies. https://covidcalltohumanity.org/what-is-pathogenic-priming/) This update states multi-system inflammatory syndrome (MIS) is more common in children and looks like Kawasaki disease (they’ve already tried blaming Kawasaki on COVID but were called out as it’s a common vaccine reaction. MIS is a reaction in someone who has had COVID weeks or months earlier and mounted a severe, delayed immune reaction, which often causes significant organ damage. (Expect to see more of this)
58 year olddies one hour after 1st dose (flash pulmonary edema likely caused by anaphylaxis which many people have experienced after receiving the COVID vaccine), an autopsy was refused.
OBGYN dies after Pfizer shot. It began with a strong set of petechiae on his feet and hands which sent him to the ER. A CBC showed his platelet count to be 0. Experts from all over the country were involved in his care, but nothing could raise his platelets causing a hemorrhagic stroke and death. “I think it is a medical certainty that the vaccine was related.” Dr. Jerry L. Spivak, an expert on blood disorders at Johns Hopkins University.
But these deaths and life-altering outcomes due to injections don’t matter because it’s “for the greater good.”
A Canadian doctor has been removed from hospital duty simply for telling others about about his vaccine injured patients. This has resulted in his income being slashed by half, which he explained is “the price of advocating for the safety of my patients.”
Severe Allergic Reactions Reported After Pfizer/BioNTech COVID-19 Vaccinations
Excerpt:
U.K. Health officials stated:
Any person with a history of a significant allergic reaction to a vaccine, medicine or food (such as previous history of anaphylactoid reaction or those who have been advised to carry an adrenaline autoinjector) should not receive the Pfizer/BioNtech vaccine.3 (See link for article)
AstraZeneca’s vaccine also has numerous short-comings:
The latest data suggests it’s only 62% effective
Many trial participants have fallen ill, including several who developed Bell’s Palsy
Nobody over 55 years of age was included in the earlier test group, which just so happened to “accidentally” receive only a half dose of the vaccine – which just happened to produce “serendipitous” results for the company.
Had older people been included, it’s likely there would have been a lower efficacy rate
Only 20% (too small of a sample size) of the highest risk patients in the global trials were over 55 years of age – all of which received much higher doses of the vaccine
Vaccination Cards Will Track Everyone Who Gets a COVID-19 Vaccine
Excerpts:
On Dec. 2, 2020, the U.S. Department of Defense (DoD) released the first images of the government’s proposed COVID-19 vaccination record card and vaccination kits that include a needle, syringe, alcohol wipes and a mask. The vaccination card, which will be issued to everyone who gets a COVID-19 vaccine, will be used by the U.S. Centers for Disease Control and Prevention (CDC) to track who gets vaccinated with the first dose of the vaccine.123456
Recipients of the vaccines will be asked to provide their cell phone numbers so pubic health officials can contact vaccinated persons by text and remind them to return to receive a second dose of COVID-19 vaccine three or four weeks later. The two doses of Pfizer/BioNTech mRNA COVID-19 (BNT162b2) need to be given 21 days apart. Moderna’s mRNA-1273 COVID-19 vaccine requires two doses to be given 28 days apart.124567
Each card, written in English and Spanish, will record the first and last name of the person receiving the vaccine, along with their date of birth, medical information, the dates in which they were vaccinated and the name of who performed the vaccination and where. It will provide spaces to record the name of the vaccine given and the name of its manufacturer. It will also have spaces that could be used to record additional booster shots in the future.36
Evidently CVS and Walgreens have established very elaborate tracking systems to set up appointments and notify people.
some companies are dangling carrots by promising that vaccinated employees will be able to forgo temperature checks and/or other PPE requirements and others are giving out cash bonuses to those who get vaccinated
renaming adverse reactions as “immune responses,” to make it more palatable
Canadians who refuse the COVID-19 vaccine should be prepared to comply with a mandatory mask rule and to be restricted in their ability to move about society
They will change the way the PCR test is done by lowering the number of cycles so there are fewer positive test results, which will make it appear to stop new cases
They will restrict the definition of a “COVID case”, for example demanding a fever of 100 for 48 consecutive hours. The drop in cases will be attributed to the vaccine.
If more fear and punishment is desired however, a reverse technique will be applied by cycling PCR tests upward and lessening the requirements for a “COVID case”
Any harm or death caused by the vaccine will be attributed to COVID-19
Many other tactics are listed (many of which have already been done)
if someone is tested by PCR as positive when a threshold of 35 cycles or higher is used (as is the rule in most laboratories in Europe and the US), the probability that said person is infected is less than 3%, and the probability that said result is a false positive is 97%.
The Stanford test would have prevented lockdowns, masks, and the 3 years of tyranny that followed – all of which were fruitless, and in fact made thingsmuchworse, which is why they ignored it. It would have put a big ugly dent in their plan.
Faulty testing has also been used against Lyme/MSIDS patients – for over 40 years which continues to this day. Everyone admits the tests are abominable but nothing is done about it.
despite this, the CDC recommended newborns be tested for COVID twice and separated from mothers with confirmed or suspected COVID. Never forget this travesty and never trust this agency again!
local governments hired “contract tracers” who were empowered to order the confinement of individuals at home even if they were asymptomatic. WI governor Tony Evers received 1,000 applications for tracing jobs at one point. NY contract tracers were paid $65K to rat our their neighbors and restaurant owners were required to keep logs of their guests as blackmail for the condition of re-opening. Never, ever forget this!
tests have graphene silver, aluminum, titanium, glass fibers in them which are undeclared on the package insert. These things can cause the mucus membranes to harden in those who are tested frequently
CDC admits COVID tests are wrong up to half the time and the President of Tanzania punks the WHO by showing nearly half of samples taken from goats, sheep, rabbits, fruit, birds, and even motor oil came back positive
Unofficial English translation of ‘Frauds and falsehoods in the medical field’ originally published on www.dsalud.com
The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed “genome” and even the so-called “target genes” allegedly specific to the “new coronavirus”. The test is worthless and all “positive” results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world’s leading experts on PCR, in fact says that under certain conditions anyone can test positive!
We have been warning you since March: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated for the reasons we explained last month (read the report “Can you prove thatthere are pathogenic viruses?” on our website –http://www.dsalud.com-). And in the present report we are going to offer new data that show that RT-PCR does not detect the so called SARS-CoV-2 as it is known, but fragments of human RNA and those of numerous microbes.
We have already explained the numerous problems that RT-PCR poses, recognised by organisations or governments such as the WHO or the CDC and by prestigious international experts such as Dr. Stephen Bustin who considers both the arbitrariness of establishing criteria for results and the choice of the number of cycles to be nonsense because they can lead to anyone testing positive.
In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the “human coronaviruses”. And the conclusions are extremely serious: none of the seven “human coronaviruses” have actually beenisolatedand all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea, such as these: Shwanella marina JCM, Dialistersuccinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis and a long list of others.
We are going to explain step by step the research that has led us to such an unusual conclusion.
HAVE ANY HUMAN CORONAVIRUSES BEEN ISOLATED?
During the first half of April, when the first research we conducted indicated that SARS-CoV-2 had not been isolated and since those who claimed to have done so were relying on “isolates” of previous “human coronaviruses”, we began to do a thorough review of those claimed isolates. Specifically, we reviewed the alleged isolation work of suspected human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERSCoV (in 2012). And these have been the results:
Coronavirus 229E.
Reference article: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:190-193. January 1, 1966.
Since the authors refer to other articles to explain the method of isolation – which they call Complement Fixation – we consulted a reference article for that method: that of Janet W. Hartleyet al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):931-938, May 1965. This is a procedure already in disuse that uses the antigen-antibody reaction to detect either one or the other. In the case we are dealing with, the aim was to detect the antigens of the supposed new virus but, as we have already explained, specific antibodies are needed which cannot be obtained the first time a virus is detected.
Coronavirus OC43.
Reference article: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub.
What was considered to be viral RNA was extracted from cultures without any proof that theRNA belongs to a virus.The tool used – a QIAamp kit – removes reagents, inhibitors and contaminants but what it cannot do is determine where the extracted RNA comes from. Andthere are no controls.It is then amplified by PCR and sequenced assuming (!) that it is genetic information of a virus. Finally, the author speculates about mutations, recombinations, genotypes, molecular evolution, strains and other jargon that conveys the idea -unproven- that a “virus” is being worked with.
SARS-CoV Coronavirus.
Reference article:J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.
There is no mention of purification in the article. There is not even any mention of filtration or centrifugation. It is only stated that “the viruses were isolated in fetal monkey liver cells fromnasopharyngeal aspirates and lung biopsies of two patients”. There are no controls. The only mention is of a “cytopathic effect” that is attributed to a virus and that PCR was done for known viruses and retroviruses without obtaining results. Finally, RT-PCR was done with “random initiators” and a sequence “of unknown origin” is detected to which “a weak homology with thecoronaviridiae family” is found. Then they designed primers for that sequence and when testing 44 samples from SARS patients only 22 were positive.
Coronavirus NL63.
Reference article:Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.
The authors state that “the identification of unknown pathogens using molecular biology tools isdifficult because the target sequence is not known so that PCR-specific initiators cannot be designed”.
What they used is a tool they developed themselves called VIDISCA which, they claim, does not require prior knowledge of the sequence! Is that possible? Let’s see how it works: first the culture is prepared and it is assumed that a virus is present due to the evidence of “cytopathic effect”. The novelty introduced by this method is that “restriction enzymes” are added, enzymes that cut the nucleic acid molecules at certain locations and always by the same length. In this way, if after the action of these enzymes they observe many fragments of DNA or RNA that are the same or very similar, they deduce that it comes from a virus, since the host genome would present random cuts, while the virus genome presents a large number of copies that are the same due to the replication of the virus. And is such a deduction correct? Of course not! This assumption (which adds to the previous assumption that there is a virus) does not take into account that there are “virus-like particles”, “retrovirus-like particles”, “endogenous retroviruses”, “exosomes”, “extracellular” particles and even mitochondrial DNA. In denial, there are a multitude of particles that possess the same reproductive characteristics in large quantities as “viruses” and thereforecan falsify resultsby producing large numbers of identical copies when cut by enzymes as recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling ofVIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that “no redundancy is expected in the VIDISCA insert from the host background nucleic acid except inthe case of ‘virus-like’ characteristics, i.e., high copy numbers as in mitochondrial DNA.
Coronavirus HKU1.
Reference article:Patrick C. Y. Woo and others. Characterisation and Complete GenomeSequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005.
The article, incredibly, begins with these words: “Despite extensive research in patients withrespiratory tract infections, no microbiological cause has been identified in a significant proportion of patients. RNA is extracted from non-purified cultures.”And a PCR with coronavirus genes is used. For the sequencing they use two protein databases organised in families, domains and functional sites -PFAM and INterProScan- combined with two computer programs that carry out “predictions” on how nucleotides should be combined. The text adds: “The sequences weremanually assembled and edited to produce a final sequence of the viral genome”. And onceagain there are no controls.
MERS-CoV Coronavirus.
Reference article: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man withPneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012.
The genetic material is extracted directly from the culture supernatantand sputum sample with a tool called High Puré Viral Nucleic Acid Kit and then tested with different PCRs for various known microorganisms. There is no mention of purification and there are no controls.
In short, what had been done with the first coronaviruses -and with many other supposedviruses– isto cultivate supposedly infected tissues– any “cytopathic effect” was attributed to the presence of a virus only – and then either some proteins are obtained which without anytest are considered “virus antigens” and when these “antigens” are detected in cultures it is interpreted as “isolation”, or fragments of nucleic acids are extracted assuming that they belong to a virus.
We already explained in the article published in the previous issue of the magazine that according to Dr. Stefan Lanka the so-called “cytopathic effect” is actually an effect caused by the conditions of the culture itself. This is recognised for example in the article Antibiotic-inducedrelease of small extracellular vesicles (exosomes) with surface-associated DNA published on August 15, 2017 on the website of Nature and signed by Andrea Németh and others
In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLYBEEN ISOLATED. The only thing that has been different between them are the laboratory procedures and techniques that were becoming progressively more sophisticated which, in this case, has implied not a greater accuracy but a greater capacity for deception and self-deception that has culminated in the virtual manufacture of the SARS-CoV-2.
And the obvious consequence of the lack of evidence of its isolation is that such “coronaviruses” cannot be held responsible for any disease. Moreover, all tests – of whatever kind – based on the presumed components of these “viruses” (nucleic acids or proteins) are completely disqualified as “infection tests” and even more as “diagnostics” of diseases.
MORE UNANSWERED REQUESTS
In the previous issue we already collected the answers given by the authors of several articles that supposedly described the isolation of SARS-CoV-2 in which they acknowledged that they had not “purified” which implicitly means acknowledging that the virus was not isolated. And now we are going to add one more piece of evidence: the responses given by different authorities – political and health – from various countries about the purification and isolation of SARS-CoV-2.
James McCumiskey -author of the book The Latest Conspiracy: The Biomedical Paradigm– tells us that the National Virus Reference Laboratory of Ireland requested information about it from the University of Dublin and the latter responded that“it has no records that could provide ananswer to their request”. The director of legal services of the laboratory insisted on his request to the university and the university responded as follows: “The position of the university is thatmaterial of academic debate cannot be subject to the Freedom of Information Act”. It follows from the NVR’s request that they have not cultivated SARS-CoV-2 or purified it. They only acknowledge having “detected SARS-CoV-2 RNA in diagnostic samples.”
On June 22, a group of experts sent a consultation in similar terms to British Prime Minister BorisJohnson. The letter was signed by Dr. Kevin Corbett, Piers Corbyn – professor at ImperialCollege London -, the engineer and independent researcher – who we interviewed in the journal at the time – David Crowe, Dr. Andrew Kaufman, the Edinburgh professor of biology RogerWatson and the biologist and chemist David Rasnick – and to this day they still have not received a reply!
Another similar request – in this case to the National Research Council of Canada – received the following response: “We have not been able to carry out a complete search of the NRC’s recordsso we regret to inform you that no records have been identified that respond to your request.”
We will add that two journalists have been sending similar requests – under the Freedom of Information Act – to various institutions in Canada, New Zealand, Australia, Germany, the United Kingdom and the United States, and as of September 5, twelve institutions have responded, all indicating the same thing: that they have no record of work describing the isolation of the virus that is supposed to cause Covid-19. The details and the answers can be seen at: https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-of-covid-19-virus-isolation/
LOOKING FOR THE ORIGIN OF THE FALSE GENOME
The question we asked ourselves then was: if the sequences that have been published do not belong – as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local AlignmentSearch Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results.
First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these:
China CDC protocol: uses ORF1ab and N genes as target.
Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to be SARS.CoV-2 specific).
United States CDC protocol: uses three fragments of the N gene.
Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses.
Charite Protocol (Germany): uses the E, N and RdRP genes.
Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.
National Institute of Health Thailand protocol: uses the N gene.
We then introduced the sequence of the primers – the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) – into the BLAST so that it could search for them in two databases: a collection of microbe genomes and the one corresponding to the human genome.
THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES!
Let’s see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similarsequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)– and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.
We then returned to the home page and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we screen captured again (image 2). And it turns out that the sequence entered coincides with 74sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%.
And that indicates that the sequence of that initial PCR primer that is supposed to be specificto SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well!
We then decided to repeat the operation but with the final or reverse primer – which is CTCCCTTTGTGTGTGT – and the results were similar.
Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the “SARS-CoV-2 genome” and although thousands of laboratories claim to have isolated and sequenced it – a false claim as we have explained in previous reports- we decided to go to the National Centre for BiotechnologyInformation website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903. Once there, we located the “target sequence”, a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the “genome”, which is this one:
With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100%and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed “target sequence” of SARS-CoV-2 both in microbes and in our own genome.
Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472:
We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage ofidentity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen atrandom and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid.
We finally decided to test with the S gene which is said to generate the structural “spike” proteins that are key to entry into the cell and was subsequently considered to be the most specific SARS-CoV-2 gene. Since it is a gene whose sequence is much longer – 3821 nucleotides between positions 21,563 and 25,384 – we tested with two fragments chosen at random within that gene and the first – TTGGCAAAATTCAAGACTCACTTTC – resulted in another hundred microbe sequences and 93 sequences of the human genome and the second – CTTGCTGCTACTAAATGCAGAGTGT – a hundred microbial sequences and 90 of the human genome.
Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were once again similar: a hundred microbe sequences and 93 sequences of the human genome withan identity percentage between 94.12% and 100%!
CONCLUSIONS
The consequence of all that we have just explained is clear and immediate: THERE IS NO VALIDTEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that
ALL THE NUMBERS OF “CASES”, “INFECTED”, “SICK”, “Asymptomatic” OR “DEAD DUE TO COVID-19” LACK A SCIENTIFIC BASE AND ALL “POSITIVES” ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable.
We end by adding that even the WHO itself does not really believe in these tests. Just read the document published last September 11 as a laboratory guide for SARS-CoV-2 entitled Diagnostictests for SARS-CoV-2 – it is available at https://apps.who.int/iris/rest/bitstreams/1302661/retrieve– and it literally says on page 5: “Whenever possible, suspected active infection shouldbe tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target”. That is, WHOagrees to use non-specific sequences to detect SARS-CoV-2.
That is not all because the manual later states, “An optimal diagnosis consists of a NAAT test withat least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used.”
The WHO manual states, “One or more negative results do not necessarily rule out SARS-CoV-2 infection.There are a number of factors that can produce a negative result in an infected individual including poor quality of the sample, late collection of the sample, inadequate handling, or technical reasons inherent in the test, such as mutation of the virus or inhibition of PCR.”
What are the judges waiting for to act on their own initiative?
Jesus Garcia Blanca
Note:the author publicly thanksJuan Pedro Aparicio Alcarazfor his patient and meticulous collaborative work in the search for scientific articles and for his tedious work with the BLAST.
Disclaimer: This article is not intended to provide medical advice, diagnosis or treatment. Views expressed here do not necessarily reflect those of GreenMedInfo or its staff.
__________________________
**Comment**
I’ve been posting on this since March. This lack of viral purification is foundational.Without it no test or vaccine will be effective, yet everything stems from it. Again, I can not recommend the book, “Virus Mania” more highly to understand this critical issue that unless dealt with, will continue on unabated with future supposed viral ‘pandemics’ that aren’t. https://www.torstenengelbrecht.com/en/virus-mania/
Newly obtained emails offer glimpses into how a narrative of certainty developed about the natural origins of the novel coronavirus SARS-CoV-2, while key scientific questions remained. The internal discussions and an early draft of a scientists’ letter show experts discussing gaps in knowledge and unanswered questions about lab origin, even as some sought to tamp down on “fringe” theories about the possibility the virus came from a lab.
The final letter published Feb. 6 did not mention binding sites or the possibility of a laboratory origin.
A few weeks later, the NASEM presidents’ letter appeared as an authoritative source for an influential scientists’ statement published in The Lancet that conveyed far more certainty about the origins of SARS-CoV-2. USRTK previously reported that EcoHealth Alliance President Peter Daszak drafted that statement, which asserted that “scientists from multiple countries…overwhelmingly conclude that this coronavirus originated in wildlife.” This position, the statement notes, is “further supported by a letter from the presidents of the US National Academies of Science, Engineering, and Medicine.”
No less than three out of four reappearances of SARS have been attributed to safety breaches.
Considering the potential for a massively lethal pandemic, I believe it’s safe to say that BSL 3 and 4 laboratories pose a very real and serious existential threat to humanity.
U.S. biowarfare programs employ some 13,000 scientists,40 all of whom are hard at work creating ever-deadlier pathogens, while the public is simply told to trust that these pathogens will never be released, either involuntarily or voluntarily.
With sufficient evidence, certain researchers and public health authorities could face life behind bars for their involvement, which is the penalty for bioterrorism under the Anti-Terrorism Act. All things considered, there’s virtually no benefit to gain-of-function research, but plenty of risk.
